<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3.dtd">
<article article-type="research-article" dtd-version="1.3" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xml:lang="en"><front><journal-meta><journal-id journal-id-type="publisher-id">veterinary</journal-id><journal-title-group><journal-title xml:lang="en">Veterinary Science Today</journal-title><trans-title-group xml:lang="ru"><trans-title>Ветеринария сегодня</trans-title></trans-title-group></journal-title-group><issn pub-type="ppub">2304-196X</issn><issn pub-type="epub">2658-6959</issn><publisher><publisher-name>"Veinard"</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.29326/2304-196X-2025-14-1-101-108</article-id><article-id custom-type="elpub" pub-id-type="custom">veterinary-899</article-id><article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject></subj-group><subj-group subj-group-type="section-heading" xml:lang="en"><subject>ORIGINAL ARTICLES | GENERAL ISSUES</subject></subj-group><subj-group subj-group-type="section-heading" xml:lang="ru"><subject>ОРИГИНАЛЬНЫЕ СТАТЬИ | ОБЩИЕ ВОПРОСЫ</subject></subj-group></article-categories><title-group><article-title>PCR-RFLP analysis of insecticide resistance to pyrethroids, organophosphates and carbamates in Musca domestica L.</article-title><trans-title-group xml:lang="ru"><trans-title>Анализ инсектицидной устойчивости к пиретроидам, фосфорорганическим соединениям и карбаматам у Musca domestica L. методом ПЦР-ПДРФ</trans-title></trans-title-group></title-group><contrib-group><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-3926-4754</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Мельничук</surname><given-names>А. Д.</given-names></name><name name-style="western" xml:lang="en"><surname>Melnichuk</surname><given-names>A. D.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Мельничук Анастасия Дмитриевна, младший научный сотрудник лаборатории молекулярной биологии и биотехнологии насекомых</p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Anastasia D. Melnichuk, Junior Researcher, Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">melnichukad1999@gmail.com</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-3607-3706</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Крестоношина</surname><given-names>К. С.</given-names></name><name name-style="western" xml:lang="en"><surname>Krestonoshina</surname><given-names>K. S.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Крестоношина Ксения Сергеевна, заведующий лабораторией молекулярной биологии и  биотехнологии насекомых</p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Kseniya S. Krestonoshina, Head of Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">krutko.k.s@hotmail.com</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-3194-873X</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Кинарейкина</surname><given-names>А. Г.</given-names></name><name name-style="western" xml:lang="en"><surname>Kinareikina</surname><given-names>A. G.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Кинарейкина Анна Григорьевна, аспирант, младший научный сотрудник лаборатории молекулярной биологии и биотехнологии насекомых</p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Anna G. Kinareikina, Postgraduate Student, Junior Researcher, Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">kinareickina@yandex.ru</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-9688-5207</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Маслакова</surname><given-names>К. Ю.</given-names></name><name name-style="western" xml:lang="en"><surname>Maslakova</surname><given-names>K. Yu.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Маслакова Ксения Юрьевна, младший научный сотрудник лаборатории молекулярной биологии и  биотехнологии насекомых</p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Kseniya Yu. Maslakova, Junior Researcher, Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">k.y.maslakova@gmail.com</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-7546-485X</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Янгирова</surname><given-names>Л. Я.</given-names></name><name name-style="western" xml:lang="en"><surname>Yangirova</surname><given-names>L. Ya.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Янгирова Лиана Януровна, аспирант, младший научный сотрудник лаборатории молекулярной биологии и биотехнологии насекомых</p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Liana Ya. Yangirova, Postgraduate Student, Junior Researcher, Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">lianayangirova137@gmail.com</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-0872-8509</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Силиванова</surname><given-names>Е. А.</given-names></name><name name-style="western" xml:lang="en"><surname>Silivanova</surname><given-names>E. A.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Силиванова Елена Анатольевна, канд. биол. наук, ведущий научный сотрудник лаборатории молекулярной биологии и  биотехнологии насекомых </p><p>ул. Институтская, 2, г. Тюмень, 625041</p></bio><bio xml:lang="en"><p>Elena A. Silivanova, Cand. Sci. (Biology), Leading Researcher, Laboratory of Insect Molecular Biology and Biotechnology</p><p>2 Institutskaya str., Tyumen 625041</p></bio><email xlink:type="simple">sylivanovaea@mail.ru</email><xref ref-type="aff" rid="aff-1"/></contrib></contrib-group><aff-alternatives id="aff-1"><aff xml:lang="ru"><institution>Всероссийский научно-исследовательский институт ветеринарной энтомологии и арахнологии – филиал ФГБУН Федерального исследовательского центра Тюменского научного центра Сибирского отделения Российский академии наук (ВНИИВЭА – филиал ТюмНЦ СО РАН)</institution><country>Россия</country></aff><aff xml:lang="en"><institution>All-Russian Scientific Research Institute of Veterinary Entomology and Arachnology – Branch of Federal State Institution Federal Research Centre Tyumen Scientific Centre of Siberian Branch of the Russian Academy of Sciences</institution><country>Russian Federation</country></aff></aff-alternatives><pub-date pub-type="collection"><year>2025</year></pub-date><pub-date pub-type="epub"><day>22</day><month>03</month><year>2025</year></pub-date><volume>14</volume><issue>1</issue><fpage>101</fpage><lpage>108</lpage><permissions><copyright-statement>Copyright &amp;#x00A9; Melnichuk A.D., Krestonoshina K.S., Kinareikina A.G., Maslakova K.Y., Yangirova L.Y., Silivanova E.A., 2025</copyright-statement><copyright-year>2025</copyright-year><copyright-holder xml:lang="ru">Мельничук А.Д., Крестоношина К.С., Кинарейкина А.Г., Маслакова К.Ю., Янгирова Л.Я., Силиванова Е.А.</copyright-holder><copyright-holder xml:lang="en">Melnichuk A.D., Krestonoshina K.S., Kinareikina A.G., Maslakova K.Y., Yangirova L.Y., Silivanova E.A.</copyright-holder><license license-type="creative-commons-attribution" xlink:href="https://creativecommons.org/licenses/by/4.0/" xlink:type="simple"><license-p>This work is licensed under a Creative Commons Attribution 4.0 License.</license-p></license></permissions><self-uri xlink:href="https://veterinary.arriah.ru/jour/article/view/899">https://veterinary.arriah.ru/jour/article/view/899</self-uri><abstract><sec><title>Introduction</title><p>Introduction. Zoophilic flies play a significant role in animal disease transmission, and insecticide resistance being a relevant veterinary issue globally is an obstacle to effective fly population control. Molecular methods are more commonly used to monitor and diagnose insecticide resistance in insect populations.</p></sec><sec><title>Objective</title><p>Objective. The study aims to assess distribution of the main mutations associated with resistance to pyrethroids, organophosphorus compounds and carbamates in three natural populations of Musca domestica L. collected in 2021–2023 in livestock facilities of the Tyumen Oblast.</p></sec><sec><title>Materials and methods</title><p>Materials and methods. Genotyping of CYP, vssc and ace-2 genes was performed using polymerase chain reaction and restriction fragment length polymorphism.</p></sec><sec><title>Results</title><p>Results. One mutation in the vssc gene (L1014F) associated with resistance to pyrethroids and two mutations in the ace-2 gene (G342A, G342V) conferring resistance to organophosphorus compounds and carbamates were found. The resistant allele L1014F was present in 40–70% of the tested insects of all three populations with 30–55% frequency. The G342A allele was found in 10 and 60% of insects from two populations with frequencies of 5 and 30%, respectively. The G342V allele was detected in 40% insects of only one population with a frequency of 25%.</p></sec><sec><title>Conclusion</title><p>Conclusion. The results obtained indicate the potential for conferring resistance to pyrethroids, organophosphorus compounds and carbamates in the studied populations of Musca domestica, which should be taken into account when selecting disinsectants for livestock-keeping facilities and protecting animals from insects. Further molecular tests of Musca domestica flies from the regions bordering the Tyumen Oblast will be useful for developing a strategy to contain spread of resistant alleles in local populations.</p></sec></abstract><trans-abstract xml:lang="ru"><sec><title>Введение</title><p>Введение. Значимым фактором в распространении заболеваний животных являются зоофильные мухи, контроль численности которых осложняется проблемой инсектицидной резистентности, актуальной для ветеринарии и медицины во всем мире. Для мониторинга и диагностики устойчивости к инсектицидам в популяциях насекомых все большее применение находят молекулярные методы.</p></sec><sec><title>Цель исследования</title><p>Цель исследования. Оценка распространения основных мутаций, ассоциированных с резистентностью к пиретроидам, фосфорорганическим соединениям и карбаматам, в трех природных популяциях Musca domesticaL., собранных в 2021–2023 гг. в животноводческих помещениях Тюменской области.</p></sec><sec><title>Материалы и методы</title><p>Материалы и методы. Методом полимеразной цепной реакции с анализом полиморфизма длин рестрикционных фрагментов выполнено генотипирование генов CYP, vssc и ace-2.</p></sec><sec><title>Результаты</title><p>Результаты. Выявлена одна мутация в гене vssc (L1014F), связанная с устойчивостью к пиретроидам, и две мутации в гене ace-2 (G342A, G342V), обеспечивающие резистентность к фосфорорганическим соединениям и карбаматам. Резистентный аллель L1014F присутствовал у 40–70% исследованных особей всех трех популяций с частотой 30–55%. Аллель G342A обнаружен у 10 и 60% особей двух популяций с частотой 5 и 30% соответственно. Аллель G342V выявлен у 40% особей только одной популяции с частотой 25%.</p></sec><sec><title>Заключение</title><p>Заключение. Полученные результаты свидетельствуют о потенциале формирования устойчивости к пиретроидам, фосфорорганическим соединениям и карбаматам в исследованных популяциях Musca domestica, что необходимо учитывать при выборе средств для дезинсекции животноводческих помещений и защиты животных от насекомых. Дальнейшие молекулярные исследования Musca domestica из граничащих с Тюменской областью регионов будут полезны для выработки стратегии по сдерживанию распространения резистентных аллелей в локальных популяциях.</p></sec></trans-abstract><kwd-group xml:lang="ru"><kwd>комнатная муха</kwd><kwd>инсектициды</kwd><kwd>инсектицидная резистентность</kwd><kwd>маркеры устойчивости</kwd><kwd>молекулярная диагностика</kwd></kwd-group><kwd-group xml:lang="en"><kwd>house flies</kwd><kwd>insecticides</kwd><kwd>insecticide resistance</kwd><kwd>resistance markers</kwd><kwd>molecular diagnosis</kwd></kwd-group><funding-group><funding-statement xml:lang="ru">Работа выполнена в  рамках государственного задания Министерства науки и  высшего образования Российской Федерации (тема № FWRZ-2022-0022).</funding-statement><funding-statement xml:lang="en">The study was conducted within the Federal Assignment of the Ministry of Science and Higher Education of the Russian Federation (Topic No. FWRZ-2022-0022).</funding-statement></funding-group></article-meta></front><body><sec><title>INTRODUCTION</title><p>Insects are a significant factor in the spread of various human and animal diseases [<xref ref-type="bibr" rid="cit1">1</xref>][<xref ref-type="bibr" rid="cit2">2</xref>], including synanthropic and zoophilic flies, in particular Musca domestica L. house fly (Diptera: Muscidae) [3,][<xref ref-type="bibr" rid="cit4">4</xref>]. The ability of adult M. domestica to be a mechanical vector of such pathogens as helminth eggs, protozoa, viruses and bacteria, including antibiotic-resistant strains, has been demonstrated in a number of studies [<xref ref-type="bibr" rid="cit4">4</xref>][<xref ref-type="bibr" rid="cit5">5</xref>][<xref ref-type="bibr" rid="cit6">6</xref>][<xref ref-type="bibr" rid="cit7">7</xref>]. Thus, Mannheimia haemolytica, Pasteurella multocida and Histophilus somni causing bovine respiratory diseases were recovered from M. domestica collected at feedlots from animals suffering from bovine respiratory disease symptoms [<xref ref-type="bibr" rid="cit5">5</xref>]. When homogenates prepared from house flies from US dairy and livestock farms were tested, tetracycline and florphenicol resistance genes with prevalence ranging from 5 to 95.8% were identified in recovered bacteria [<xref ref-type="bibr" rid="cit6">6</xref>]. The ability of Newcastle disease virus to persist in an infectious dose in the gut of flies for four days after feeding with infected milk and for one day in chicken droppings has been shown under laboratory conditions [<xref ref-type="bibr" rid="cit7">7</xref>], which increases the risk of disease spread via flies present in poultry farms. Given the veterinary importance of zoophilic flies, it is necessary to control their numbers.</p><p>Despite the great interest in pest control biological methods, the chemical method based on the use of synthetic insecticidal agents remains widely used. Synthetic pyrethroids, neonicotinoids, organophosphorus compounds (OPCs), and carbamates are most often used for protecting animals from insects and disinsecting livestock premises both in Russia and abroad [<xref ref-type="bibr" rid="cit4">4</xref>][<xref ref-type="bibr" rid="cit8">8</xref>]. M. domestica quite rapidly develop resistance against insecticides when used intensively: for example, more than 20-fold increase of resistance to permethrin [<xref ref-type="bibr" rid="cit9">9</xref>] and alpha-cypermethrin [<xref ref-type="bibr" rid="cit10">10</xref>] was revealed under laboratory conditions over 10–20 generations. According to a number of studies, resistance to pyrethroids (deltamethrin, permethrin, beta-cyfluthrin, cypermethrin) was observed in house fly field populations in China [<xref ref-type="bibr" rid="cit11">11</xref>][<xref ref-type="bibr" rid="cit12">12</xref>], Pakistan [<xref ref-type="bibr" rid="cit9">9</xref>], Iran [<xref ref-type="bibr" rid="cit13">13</xref>], USA [<xref ref-type="bibr" rid="cit14">14</xref>], Saudi Arabia [<xref ref-type="bibr" rid="cit10">10</xref>][<xref ref-type="bibr" rid="cit15">15</xref>], the Moscow and Kaluga Oblasts of the Russian Federation [<xref ref-type="bibr" rid="cit8">8</xref>]. In the Tyumen Oblast, tolerant and exceptionally highly pyrethroid-resistant field populations were also recorded [<xref ref-type="bibr" rid="cit16">16</xref>][<xref ref-type="bibr" rid="cit17">17</xref>]. OPC-resistant house fly populations were found, for instance, in China [<xref ref-type="bibr" rid="cit12">12</xref>], Iran [<xref ref-type="bibr" rid="cit18">18</xref>], and Saudi Arabia [<xref ref-type="bibr" rid="cit15">15</xref>][<xref ref-type="bibr" rid="cit19">19</xref>]. Insecticide resistance of M. domestica field populations makes it difficult to control their numbers.</p><p>The molecular target of pyrethroids is voltage-sensitive sodium channels (vssc), and the presence of mutations in the genes encoding this protein, i.e. knock-down resistance (kdr), is recognised as a marker of resistance to pyrethroids [<xref ref-type="bibr" rid="cit14">14</xref>][<xref ref-type="bibr" rid="cit20">20</xref>]. Of the five known alleles associated with target insensitivity and, consequently, pyrethroid resistance of insects, the kdr (L1014F) and kdr-his (L1014H) are the most frequently investigated [<xref ref-type="bibr" rid="cit13">13</xref>][<xref ref-type="bibr" rid="cit14">14</xref>][<xref ref-type="bibr" rid="cit20">20</xref>]. Target insensitivity is often combined with another major mechanism of pyrethroid resistance, namely enhanced detoxification of insecticides via cytochrome P450-dependent monooxygenases (CYP). A confirmed molecular marker of this type of resistance is the presence of a 15-base pair (bp) insertion in the CYP6D1 gene [<xref ref-type="bibr" rid="cit21">21</xref>][<xref ref-type="bibr" rid="cit22">22</xref>]. Acetylcholinesterase (AChE), encoded by the ace gene, is a key enzyme of the cholinergic system and a major target of OPC and carbamate insecticides, which block the transmission of nerve impulses at cholinergic synapses. Resistance to OPC and carbamates may result from insensitivity of AChE due to mutations in the ace gene or due to mutations in the carboxylesterase gene, leading to an increase in the hydrolytic activity of the enzyme with respect to OPC [<xref ref-type="bibr" rid="cit20">20</xref>][<xref ref-type="bibr" rid="cit23">23</xref>]. M. domestica is known to have only one AChE-encoding gene, ace-2 [<xref ref-type="bibr" rid="cit24">24</xref>], and six major mutations associated with resistance to OPC and carbamates have been described in detail: V260L, A316S, G342A, G342V, F407Y, and G445A [<xref ref-type="bibr" rid="cit25">25</xref>][<xref ref-type="bibr" rid="cit26">26</xref>][<xref ref-type="bibr" rid="cit27">27</xref>].</p><p>Analysis of insecticide resistance in M. domestica field populations in Russia is traditionally carried out using toxicological methods [<xref ref-type="bibr" rid="cit8">8</xref>][<xref ref-type="bibr" rid="cit17">17</xref>][<xref ref-type="bibr" rid="cit28">28</xref>], which allow establishing the presence of a stable phenotype and the level of resistance and do not explain the mechanisms underlying insecticide resistance [<xref ref-type="bibr" rid="cit29">29</xref>]. The resistance mechanisms are defined and the potential for its formation is assessed using biochemical and molecular methods [<xref ref-type="bibr" rid="cit30">30</xref>], and these steps are critical for rationalized selection of insecticidal agents and development of insecticide application schemes. As compared to traditional toxicological methods, molecular tests provide more complete information on the population structure, and the combination of toxicological and molecular methods allows objective assessment of the level of adaptation of the population to insecticide load [<xref ref-type="bibr" rid="cit31">31</xref>]. Among molecular methods for detecting mutations associated with insecticide resistance, PCR-RFLP (polymerase chain reaction – restriction fragment length polymorphism) is used [<xref ref-type="bibr" rid="cit32">32</xref>]. The PCR-RFLP method is cost-effective, easy to implement and requires only basic molecular genetic equipment; it is widely available and is a good alternative to sequencing.</p><p>The aim of the study was to test Musca domestica flies collected from three field populations in the Tyumen Oblast for the presence of mutations in CYP, vssc and ace-2 genes associated with resistance to pyrethroids, OPC and carbamates by PCR-RFLP.</p></sec><sec><title>MATERIALS AND METHODS</title><p>The study was aimed at M. domestica flies of three field populations: Nov (56.53700°, 65.24238°), Cha (56.781583°, 65.96014°), Nik (55.55352°, 70.62864°) collected in livestock facilities of the Tyumen Oblast in 2021–2023. The first generation (F1) was obtained from the collected insects of each population under insectarium conditions, 3–5 day old adult flies were frozen and stored at –80 °C before they were used for testing.</p><p>DNA was isolated from adult flies (5 females and males of each population) using alkaline lysis [<xref ref-type="bibr" rid="cit33">33</xref>]. The amplification process was performed with GeneExplorer GE-96G (Bioer, China) using an individual primer pair for each gene. P1, P2, P3, P4 primers were used for genotyping mutations in the vssc gene, and AceF and AceR primers taken from the study of X. Qiu et al. [<xref ref-type="bibr" rid="cit32">32</xref>] were used for the ace-2 gene. For genotyping of mutation in the CYP6D1 gene, the S35 and AS2 primers and restrictase were used according to F. D. Rinkevich et al. [<xref ref-type="bibr" rid="cit34">34</xref>]. The amplification conditions were identical except for the temperature of primer annealing (Table 1): at 95 °C for 5 min, further at 95 °C for 20 s, at 62–53 °C for 30 s, at 72 °C for 30 s (5 cycles), at 95 °C for 20 s, at 60–51 °C for 30 s, at 72°C for 30 s (35 cycles), at 72 °C for 10 min. The PCR reaction mixture included: 1 µL of total DNA; 4 µL of 5X ScreenMix-HS PCR prepared mix (Eurogen, Russia); 0.3 µL of each primer (25 μM); 14.4 µL of purified sterile water (18.2 μS/cm). The restriction enzymes and test conditions are indicated in Table 1. Visualization of restriction results was performed through electrophoresis with 2% agarose gel containing ethidium bromide.</p><table-wrap id="table-1"><caption><p>Table 1</p><p>PCR-RFLP assay conditions</p></caption><table><tbody><tr><td>Gene</td><td>Primers (5’–3’)</td><td>Annealing temperature, °C</td><td>Amplicon length, bp</td><td>Restrictase</td><td>Mutation</td><td>Restriction conditions</td></tr><tr><td>vssc</td><td>P1. GTGCTGTGCGGAGAGTGG
P2. GAAGCCTCCATCCTGGGAG</td><td>60</td><td>156</td><td>Sse9I</td><td>L1014F</td><td>3 h – 55 °C;
20 min – 65 °C</td></tr><tr><td>P3. AGCTGTATACCCTTCTTCT
P4. CGAAGTTGGACAAAAGCAAA</td><td>51</td><td>220</td><td>Fat I</td><td>L1014H</td></tr><tr><td>CYP6D1</td><td>S35. AGCTGACGAAATTGATCAATCAGT
AS2. CATTGGATCATTTTTCTCATC</td><td>59</td><td>732–711</td><td>Hpy 188III</td><td>CYP6D1v</td><td>1 h – 37 °C;
20 min – 65 °C</td></tr><tr><td>ace-2</td><td>AceF. CGGTGCATTTGGGTTTCTAC
AceR. CGTAACCGCTAAGATCTGCTG</td><td>57</td><td>609</td><td>Mh1 I</td><td>G342</td><td>3 h – 37 °C;
20 min – 80 °C</td></tr><tr><td>Aco I</td><td>G342A</td><td>3 h – 37 °C;
20 min – 65 °C</td></tr></tbody></table></table-wrap></sec><sec><title>RESULTS AND DISCUSSION</title><p>The prevalence and frequency of mutations associated with resistance to pyrethroids and OPCs have been investigated in M. domestica field populations in Denmark [<xref ref-type="bibr" rid="cit35">35</xref>], Turkey [<xref ref-type="bibr" rid="cit36">36</xref>], Iran [<xref ref-type="bibr" rid="cit26">26</xref>][<xref ref-type="bibr" rid="cit37">37</xref>], USA [<xref ref-type="bibr" rid="cit14">14</xref>][<xref ref-type="bibr" rid="cit34">34</xref>], Kazakhstan [<xref ref-type="bibr" rid="cit22">22</xref>], United Arab Emirates (UAE) [<xref ref-type="bibr" rid="cit38">38</xref>] and other countries. Regarding M. domestica populations in the Russian Federation, resistance to pyrethroids and other insecticides was previously assessed using mainly toxicological methods [<xref ref-type="bibr" rid="cit8">8</xref>][<xref ref-type="bibr" rid="cit17">17</xref>][<xref ref-type="bibr" rid="cit28">28</xref>]. Data on molecular test results of the house fly field populations and the genetic potential for insecticide resistance in local populations of the Russian Federation have not been published in the open access.</p><p>Sse9I and Fat I restrictases are used for vssc genotyping with PCR-RFLP. The Sse9I restrictase cuts the amplicon into 2 fragments of 96 and 60 bp, respectively, in the presence of the L1014F mutation. The L1014H mutation is detected using the Fat I enzyme, which, in the presence of the mutation, cuts the 220 bp amplicon into fragments of 170 and 50 bp long, respectively [<xref ref-type="bibr" rid="cit22">22</xref>]. Combining the both test results, we identified the following genotypes (Fig. 1): 1014 (L/L), 1014 (L/F), 1014 (F/F). The L1014F mutation was detected in 70% of the tested flies of the Nov and Cha populations and in 40% of the flies of the Nik population (Table 2).</p><fig id="fig-1"><caption><p>Fig. 1. Electrophoregram for PCR-RFLP amplification products of the vssc gene region: A – using Sse9I restrictase; B – using Fat I restrictase; 1 –1014 (F/F), 2 – 1014 (L/F), 3 – 1014 (L/L)</p></caption><graphic xlink:href="veterinary-14-1-g001.jpeg"><uri content-type="original_file">https://cdn.elpub.ru/assets/journals/porozendo/2025/1/cJ79ba73q9iIOvRz2f4giNF2tEdSRy6Z0x9u4eWy.jpeg</uri></graphic></fig><table-wrap id="table-2"><caption><p>Table 2</p><p>Distribution of detected mutations associated with insecticide resistance in three populations of M. domestica in the Tyumen Oblast</p></caption><table><tbody><tr><td>Population</td><td>Number of flies</td><td>Proportion of flies with L1014F mutation, %</td><td>Number of flies with the genotype</td><td>Allele frequency, %</td><td>Proportion of flies with mutation, %</td><td>Number of flies with the genotype</td><td>Allele frequency, %</td></tr><tr><td>L/L</td><td>L/F</td><td>F/F</td><td>F</td><td>G342A</td><td>G342V</td><td>G/G</td><td>G/A</td><td>G/V</td><td>A</td><td>V</td></tr><tr><td>Nov</td><td>10</td><td>70</td><td>3</td><td>3</td><td>4</td><td>55</td><td>0</td><td>0</td><td>10</td><td>0</td><td>0</td><td>0</td><td>0</td></tr><tr><td>Cha</td><td>10</td><td>70</td><td>3</td><td>4</td><td>3</td><td>50</td><td>60</td><td>0</td><td>4</td><td>6</td><td>0</td><td>30</td><td>0</td></tr><tr><td>Nik</td><td>10</td><td>40</td><td>6</td><td>2</td><td>2</td><td>30</td><td>10</td><td>40</td><td>5</td><td>1</td><td>4</td><td>5</td><td>25</td></tr></tbody></table></table-wrap><p>Hpy 188III restrictase is used for CYP genotyping with PCR-RFLP. The resistant allele CYP6D1v1 is characterised by a 15 bp insertion that disrupts the recognition sequence of the Hpy 188III enzyme. As a result, after restriction, fragments of 432 and 279 bp will be characteristic of the wild-type genotype, and 732 bp will be characteristic of the genotype carrying the mutation [<xref ref-type="bibr" rid="cit34">34</xref>]. No resistant allele of CYP6D1v1 was detected during the study, but Figure 2 shows that in some flies the 432 bp band is additionally cut by the Hpy 188III enzyme.</p><fig id="fig-2"><caption><p>Fig. 2. Electrophoregram for PCR-RFLP amplification products of CYP6D1 gene region using Hpy 188III restrictase: 1–20 – different M. domestica species</p></caption><graphic xlink:href="veterinary-14-1-g002.jpeg"><uri content-type="original_file">https://cdn.elpub.ru/assets/journals/porozendo/2025/1/xyLWzecNWJHRRwrLVoemuK4emIMvlUlGrDaMI7e1.jpeg</uri></graphic></fig><p>PCR-RFLP assay of the ace-2 gene was performed using Mh1 I and Aco I enzymes. The Mh1 I restrictase has a restriction site (GGC) that is characteristic of the wild-type genotype, 342G. After restriction, the two fragments of 361 and 248 bp detected in the electrophoregram are indicative of a wild type genotype, and a 609 bp fragment is indicative of the G342A or G342V mutation. The Aco I restrictase identifies the G342A mutation and cuts the amplicon into 2 fragments of 361 and 248 bp long. Thus, combining the two assays allows the detection of 6 different genotypes [<xref ref-type="bibr" rid="cit32">32</xref>]. In our study we managed to detect 3 different genotypes (Fig. 3). G342A or G342V mutations were found in the Nov population. In the Nik population, the proportion of flies with G342A and G342V mutations was 10 and 40%, respectively. In the Cha population, only G342A mutation was detected in 60% of flies (Table 2).</p><fig id="fig-3"><caption><p>Fig. 3. Electrophoregram for PCR-RFLP amplification products of ace-2 gene region: A – using Mh1 I restrictase;</p></caption><graphic xlink:href="veterinary-14-1-g003.jpeg"><uri content-type="original_file">https://cdn.elpub.ru/assets/journals/porozendo/2025/1/iFLxUWwqlHV71ExMdp937aTbiw95M7ecM9GW85sp.jpeg</uri></graphic></fig><p>In total, 3 (L1014F, G342A, G342V) out of 5 tested mutations were identified using the PCR-RFLP. The distribution frequencies of the resistant alleles in the three populations are presented in Table 2. The kdr mutation (L1014F) was found in the hetero- and homozygous state in 7 out of 10 flies of the Nov and Cha populations and in 4 out of 10 flies of the Nik population. The kdr-his mutation (L1014H) was not detected in any of the three populations. Test results for field populations of M. domestica in Turkey showed that the frequency of kdr and kdr-his alleles was 8 and 20%, respectively [<xref ref-type="bibr" rid="cit36">36</xref>]. A survey of six field populations of the house fly in Kazakhstan showed the presence of the kdr allele in one of the populations with a frequency of 5% and the kdr-his allele in another population with a frequency of 14.3% in the heterozygous state [<xref ref-type="bibr" rid="cit22">22</xref>]. Interestingly, the L1014F mutation was not reported in the Iranian population of M. domestica, and the percentage of kdr-his polymorphism (L1014H) was low at 4.7% [<xref ref-type="bibr" rid="cit37">37</xref>]. On the contrary, in the USA, the kdr (L1014F) mutation was present in all six studied populations of house flies found in poultry and livestock farms, and kdr-his (L1014H) mutation was present in five populations. The frequency of kdr-his and kdr alleles varied widely in the populations, ranging from 12.5–28.1% and 7.1–76.6%, respectively [<xref ref-type="bibr" rid="cit14">14</xref>]. A recent paper reported the detection of the kdr allele in M. domestica flies from the United Arab Emirates with the frequencies ranging from 9.4 to 46.9% [<xref ref-type="bibr" rid="cit38">38</xref>]. The frequency of the resistant kdr allele (30–55%) in house fly populations in the Tyumen Oblast is comparable to that of populations from the USA and the UAE.</p><p>According to literature data, the knockdown resistance was first reported in house flies in the 1950s as insensitivity of sodium channels to the action of dichlorodiphenyltrichloroethane (DDT). It was later found that such resistance was associated with a nucleotide substitution (cytosine for thymine) in the vssc gene, resulting in the replacement of leucine with phenylalanine at position 1014 (L1014F) of the sodium channel alpha subunit [<xref ref-type="bibr" rid="cit39">39</xref>]. As a result, structural changes in the protein molecule occur, affecting the interaction of the insecticide with the target. This mutation also leads to the formation of resistance to pyrethroids, as they have a similar mechanism of action to DDT. The L1014F mutation, in addition to M. domestica, has been found in other two-winged insects (e.g., Culex and Anopheles mosquitoes, Haematobia fatheads), red cockroach (Blattella germanica), cat flea (Ctenocephalides felis), rat flea (Xenopsylla cheopis), triatomine bugs (e.g., Triatoma infestans), and other arthropods [<xref ref-type="bibr" rid="cit39">39</xref>][<xref ref-type="bibr" rid="cit40">40</xref>].</p><p>One of the sufficiently described mechanisms of resistance to pyrethroids in insects is the enhancement of detoxification mediated by cytochrome P450-dependent monooxygenases (CYP) [<xref ref-type="bibr" rid="cit41">41</xref>]. This type of insecticide resistance in M. domestica is associated with increased expression of the CYP6D1 gene in the presence of 15 bp insertion (CYP6D1v1 allele) [<xref ref-type="bibr" rid="cit34">34</xref>]. In the USA, the resistant CYP6D1v1 allele was detected with a frequency of &gt; 75% in 5 studied populations of M. domestica [<xref ref-type="bibr" rid="cit14">14</xref>]. According to V. Taşkın et al., the frequency of CYP6D1v1 in house fly population from Turkey was 39% [<xref ref-type="bibr" rid="cit36">36</xref>]. In Kazakhstan, this allele was present in 3 out of 6 populations of M. domestica with a much lower frequency: 4.4–6.3% [<xref ref-type="bibr" rid="cit22">22</xref>]. In our study, PCR-RFLP assay did not reveal an insertion characteristic of the resistant allele of CYP6D1v; however, a mutation described earlier for M. domestica laboratory culture was detected in flies from the Nov and Cha populations [<xref ref-type="bibr" rid="cit42">42</xref>]. Freeman J. C. et al. rightly pointed out in their study that CYP6D1v1 is only partially responsible for the increased expression level of CYP6D1 [<xref ref-type="bibr" rid="cit14">14</xref>]. Due to the high evolutionary plasticity of CYPs, their other representatives or other mutations not yet described may be involved in the formation of resistance to insecticides – in general, and pyrethroids – in particular, in local M. domestica populations.</p><p>Detection of a rather large percentage of flies with the kdr mutation among M. domestica of the three field populations under study is not surprising, since, according to the surveys, pyrethroids (mainly deltamethrin and cyfluthrin) had been used for premise disinsection and animal protection from annoying insects for several seasons in livestock farms where the flies were collected. The use of these insecticides in this case served as a selection factor that apparently allowed the kdr (L1014F) mutation to gain a foothold in the populations under study. It is believed that in the presence of the kdr (L1014F) mutation, a higher level of pyrethroid resistance is formed than in the presence of the kdr-his (L1014H) mutation [<xref ref-type="bibr" rid="cit36">36</xref>][<xref ref-type="bibr" rid="cit37">37</xref>]. In order to slow down the emergence of populations highly resistant to pyrethroids, it is advisable to replace pyrethroids with insecticides with a different mechanism of action (e.g., pyrroles, oxadiazines, insect growth regulators, etc.) in the studied livestock farms.</p><p>The higher Diptera have only one AChE-encoding gene and, accordingly, mutations providing resistance to OPCs and carbamates in this group of insects were found only in the ace-2 gene. Such mutations individually or in combination lead to amino acid substitutions close to the catalytic triad of the active centre of the enzyme, affecting the orientation of the amino acids of the triad and limiting the access and/or binding of bulk insecticides (enzyme inhibitors) in the substrate centre of the protein [<xref ref-type="bibr" rid="cit25">25</xref>]. Six such mutations have been described in detail for M. domestica: V260L, A316S, G342A, G342V, F407Y and G445A [<xref ref-type="bibr" rid="cit25">25</xref>][<xref ref-type="bibr" rid="cit28">28</xref>]. In addition to M. domestica, resistance to OPCs and carbamates is known to be formed by a similar mechanism in other insect species, such as the green meat fly Lucilia cuprina [<xref ref-type="bibr" rid="cit43">43</xref>], Drosophila melanogaster [<xref ref-type="bibr" rid="cit44">44</xref>][<xref ref-type="bibr" rid="cit45">45</xref>], and tephritid fruit flies Bactrocera oleae [<xref ref-type="bibr" rid="cit46">46</xref>] and Bactrocera dorsalis [<xref ref-type="bibr" rid="cit47">47</xref>]. In their study S. Başkurt et al. [<xref ref-type="bibr" rid="cit48">48</xref>] indicated equivalent substitutions of amino acid residues in the AChE molecule for M. domestica and D. melanogaster. Literature data indicate that mutations underlying resistance of the house fly to OPCs and carbamates are widespread worldwide. Thus, resistant alleles G342A and G342V were found in flies of field populations of M. domestica of the USA, China, Iran, Kazakhstan [<xref ref-type="bibr" rid="cit14">14</xref>][<xref ref-type="bibr" rid="cit22">22</xref>][<xref ref-type="bibr" rid="cit26">26</xref>][<xref ref-type="bibr" rid="cit49">49</xref>]. In house fly populations from Kazakhstan, G342A and G342V resistant alleles were found with a frequency of 27–48 and 0–20%, respectively [<xref ref-type="bibr" rid="cit22">22</xref>]. G342A and G342V mutations were detected in 30 and 40% of M. domestica flies from Iran, respectively [<xref ref-type="bibr" rid="cit26">26</xref>]. In our study, the G342V resistant allele was only present in the Nik population (the mutation was present in 40% of flies) with a frequency of 25%, the G342A allele in the Nik (in 10% of flies) and Cha (in 60% of flies) populations with a frequency of 5 and 30%, respectively, and these mutations were not detected in the Nov population. It is assumed that the allele with the G342V mutation plays a more significant role in AChE insensitivity and the formation of a high level of resistance to certain insecticides compared to that with G342A mutation [<xref ref-type="bibr" rid="cit14">14</xref>][<xref ref-type="bibr" rid="cit25">25</xref>][<xref ref-type="bibr" rid="cit49">49</xref>].</p></sec><sec><title>CONCLUSION</title><p>In this study, PCR-RFLP assay showed presence of the kdr allele (L1014F), responsible for resistance to pyrethroids, with a frequency of 30–55% and the G342A/V alleles associated with resistance to OPCs and carbamates, with a frequency of 5–30% in flies from three and two field populations of M. domestica in the Tyumen Oblast, respectively. The presented data indicate the potential for formation of resistance to pyrethroids, OPCs and carbamates in the studied populations. On the basis of the obtained results it is possible to recommend replacement of these insecticides during disinsection of livestock facilities with preparations from other groups in order to mitigate the spread of resistant alleles in local populations of M. domestica. Further molecular studies of insects from different regions of the country are required to assess more fully the situation regarding resistance to pyrethroids, OPCs and carbamates and the potential for its formation in M. domestica in Russia.</p></sec></body><back><ref-list><title>References</title><ref id="cit1"><label>1</label><citation-alternatives><mixed-citation xml:lang="ru">Домацкий В. Н., Федорова О. А., Сибен А. Н. Эпизоотологическое и эпидемиологическое значение кровососущих двукрылых насекомых в условиях Крайнего Севера (обзор). Российский паразитологический журнал. 2018; 12 (4): 73–76. https://doi.org/10.31016/1998-8435-2018-12-4-73-76</mixed-citation><mixed-citation xml:lang="en">Domatskiy V. N., Fedorova O. A., Siben A. N. Epizootological and epidemiological place of sanguivorous dipterans in a climate of the Arctic (review). Russian Journal of Parasitology. 2018; 12 (4): 73–76. https://doi.org/10.31016/1998-8435-2018-12-4-73-76 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit2"><label>2</label><citation-alternatives><mixed-citation xml:lang="ru">Давлианидзе Т. А., Еремина О. Ю. Санитарно-эпидемиологическое значение и резистентность к инсектицидам природных популяций комнатной мухи Musca domestica. Вестник защиты растений. 2021; 104 (2): 72–86. https://doi.org/10.31993/2308-6459-2021-104-2-14984</mixed-citation><mixed-citation xml:lang="en">Davlianidze T. A., Eremina O. Yu. Sanitary and epidemiological significance and resistance to insecticidesin the housefly Musca domestica. Plant Protection News. 2021; 104 (2): 72–86. https://doi.org/10.31993/2308-6459-2021-104-2-14984 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit3"><label>3</label><citation-alternatives><mixed-citation xml:lang="ru">Новак М. Д., Енгашев С. В., Мироненко А. В., Белова Л. М., Енгашева Е. С., Филимонов Д. Н. Динамика численности слепней и зоофильных мух в Центральном районе Российской Федерации. Ветеринария. 2020; (6): 28–32. https://doi.org/10.30896/0042-4846.2020.23.6.28-32</mixed-citation><mixed-citation xml:lang="en">Novak M. D., Engashev S. V., Mironenko A. V., Belova L. M., Engasheva E. S., Filimonov D. N. Dynamics of population size of blinds and zoophilic flies in the Central area of the Russian Federation. Veterinariya. 2020; (6): 28–32. https://doi.org/10.30896/0042-4846.2020.23.6.28-32 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit4"><label>4</label><citation-alternatives><mixed-citation xml:lang="ru">Geden C. J., Nayduch D., Scott J. G., Burgess E. R. IV, Gerry A. C., Kaufman P. E., et al. House fly (Diptera: Muscidae): biology, pest status, current management prospects, and research needs. Journal of Integrated Pest Management. 2021; 12 (1):39. https://doi.org/10.1093/jipm/pmaa021</mixed-citation><mixed-citation xml:lang="en">Geden C. J., Nayduch D., Scott J. G., Burgess E. R. IV, Gerry A. C., Kaufman P. E., et al. House fly (Diptera: Muscidae): biology, pest status, current management prospects, and research needs. Journal of Integrated Pest Management. 2021; 12 (1):39. https://doi.org/10.1093/jipm/pmaa021</mixed-citation></citation-alternatives></ref><ref id="cit5"><label>5</label><citation-alternatives><mixed-citation xml:lang="ru">Neupane S., Nayduch D., Zurek L. House flies (Musca domestica) pose a risk of carriage and transmission of bacterial pathogens associated with bovine respiratory disease (BRD). Insects. 2019; 10 (10):358. https://doi.org/10.3390/insects10100358</mixed-citation><mixed-citation xml:lang="en">Neupane S., Nayduch D., Zurek L. House flies (Musca domestica) pose a risk of carriage and transmission of bacterial pathogens associated with bovine respiratory disease (BRD). Insects. 2019; 10 (10):358. https://doi.org/10.3390/insects10100358</mixed-citation></citation-alternatives></ref><ref id="cit6"><label>6</label><citation-alternatives><mixed-citation xml:lang="ru">Neupane S., Talley J. L., TaylorD. B., NayduchD. Bacterial communities and prevalence of antibiotic resistance genes carried within house flies (Diptera: Muscidae) associated with beef and dairy cattle farms. Journal of Medical Entomology. 2023; 60 (6): 1388–1397. https://doi.org/10.1093/jme/tjad112</mixed-citation><mixed-citation xml:lang="en">Neupane S., Talley J. L., TaylorD. B., NayduchD. Bacterial communities and prevalence of antibiotic resistance genes carried within house flies (Diptera: Muscidae) associated with beef and dairy cattle farms. Journal of Medical Entomology. 2023; 60 (6): 1388–1397. https://doi.org/10.1093/jme/tjad112</mixed-citation></citation-alternatives></ref><ref id="cit7"><label>7</label><citation-alternatives><mixed-citation xml:lang="ru">Chakrabarti S., King D. J., Cardona C. J., Gerry A. C. Persistence of exoticNewcastle disease virus (ENDV) in laboratory infected Musca domestica and Fannia canicularis. Avian Diseases. 2008; 52 (3): 375–379. https://doi.org/10.1637/8173-111407-Reg</mixed-citation><mixed-citation xml:lang="en">Chakrabarti S., King D. J., Cardona C. J., Gerry A. C. Persistence of exoticNewcastle disease virus (ENDV) in laboratory infected Musca domestica and Fannia canicularis. Avian Diseases. 2008; 52 (3): 375–379. https://doi.org/10.1637/8173-111407-Reg</mixed-citation></citation-alternatives></ref><ref id="cit8"><label>8</label><citation-alternatives><mixed-citation xml:lang="ru">Давлианидзе Т. А., Еремина О. Ю., Олифер В. В. Резистентность к инсектицидам комнатной мухи Muscadomestica в центре Европейской части России. Вестник защиты растений. 2022; 105 (3): 114–121. https://doi.org/10.31993/2308-6459-2022-105-3-15346</mixed-citation><mixed-citation xml:lang="en">Davlianidze T. A., EreminaO. Yu., OliferV. V. Resistance to insecticides of houseflyMusca domestica in the center ofthe European part of Russia. Plant Protection News. 2022; 105 (3): 114–121. https://doi.org/10.31993/2308-6459-2022-105-3-15346 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit9"><label>9</label><citation-alternatives><mixed-citation xml:lang="ru">Khan H. A. A. Characterization of permethrin resistance in a Musca domestica strain: resistance development, cross-resistance potential and realized heritability. Pest Management Science. 2019; 75 (11): 2969–2974. https://doi.org/10.1002/ps.5409</mixed-citation><mixed-citation xml:lang="en">Khan H. A. A. Characterization of permethrin resistance in a Musca domestica strain: resistance development, cross-resistance potential and realized heritability. Pest Management Science. 2019; 75 (11): 2969–2974. https://doi.org/10.1002/ps.5409</mixed-citation></citation-alternatives></ref><ref id="cit10"><label>10</label><citation-alternatives><mixed-citation xml:lang="ru">Abbas N., Hafez A. M. Alpha-cypermethrin resistance in Musca domestica: Resistance instability, realized heritability, risk assessment, and insecticide cross-resistance. Insects. 2023; 14 (3):233. https://doi.org/10.3390/insects14030233</mixed-citation><mixed-citation xml:lang="en">Abbas N., Hafez A. M. Alpha-cypermethrin resistance in Musca domestica: Resistance instability, realized heritability, risk assessment, and insecticide cross-resistance. Insects. 2023; 14 (3):233. https://doi.org/10.3390/insects14030233</mixed-citation></citation-alternatives></ref><ref id="cit11"><label>11</label><citation-alternatives><mixed-citation xml:lang="ru">Li Q., Huang J., Yuan J. Status and preliminary mechanism of resistance to insecticidesin a field strain of housefly (Musca domestica, L). Revista Brasileira de Entomologia. 2018; 62 (4): 311–314. https://doi.org/10.1016/j.rbe.2018.09.003</mixed-citation><mixed-citation xml:lang="en">Li Q., Huang J., Yuan J. Status and preliminary mechanism of resistance to insecticidesin a field strain of housefly (Musca domestica, L). Revista Brasileira de Entomologia. 2018; 62 (4): 311–314. https://doi.org/10.1016/j.rbe.2018.09.003</mixed-citation></citation-alternatives></ref><ref id="cit12"><label>12</label><citation-alternatives><mixed-citation xml:lang="ru">Wang J.-N., Hou J., Wu Y.-Y., Guo S., Liu Q.-M., Li T.-Q., Gong Z.-Y. Resistance of house fly, Musca domestica L. (Diptera: Muscidae), to five insecticides in Zhejiang Province, China: The situation in 2017. Canadian Journal of Infectious Diseases and Medical Microbiology. 2019; 2019 (1):4851914. https://doi.org/10.1155/2019/4851914</mixed-citation><mixed-citation xml:lang="en">Wang J.-N., Hou J., Wu Y.-Y., Guo S., Liu Q.-M., Li T.-Q., Gong Z.-Y. Resistance of house fly, Musca domestica L. (Diptera: Muscidae), to five insecticides in Zhejiang Province, China: The situation in 2017. Canadian Journal of Infectious Diseases and Medical Microbiology. 2019; 2019 (1):4851914. https://doi.org/10.1155/2019/4851914</mixed-citation></citation-alternatives></ref><ref id="cit13"><label>13</label><citation-alternatives><mixed-citation xml:lang="ru">Ahmadi E., Khajehali J., Rameshgar F. Evaluation of resistance to permethrin, cypermethrin and deltamethrin in different populations of Musca domestica (L.), collected from the Iranian dairy cattle farms. Journal of Asia-Pacific Entomology. 2020; 23 (2): 277–284. https://doi.org/10.1016/j.aspen.2020.01.014</mixed-citation><mixed-citation xml:lang="en">Ahmadi E., Khajehali J., Rameshgar F. Evaluation of resistance to permethrin, cypermethrin and deltamethrin in different populations of Musca domestica (L.), collected from the Iranian dairy cattle farms. Journal of Asia-Pacific Entomology. 2020; 23 (2): 277–284. https://doi.org/10.1016/j.aspen.2020.01.014</mixed-citation></citation-alternatives></ref><ref id="cit14"><label>14</label><citation-alternatives><mixed-citation xml:lang="ru">Freeman J. C., RossD. H., ScottJ. G. Insecticide resistance monitoring of house fly populationsfrom the United States. Pesticide Biochemistry and Physiology. 2019; 158: 61–68. https://doi.org/10.1016/j.pestbp.2019.04.006</mixed-citation><mixed-citation xml:lang="en">Freeman J. C., RossD. H., ScottJ. G. Insecticide resistance monitoring of house fly populationsfrom the United States. Pesticide Biochemistry and Physiology. 2019; 158: 61–68. https://doi.org/10.1016/j.pestbp.2019.04.006</mixed-citation></citation-alternatives></ref><ref id="cit15"><label>15</label><citation-alternatives><mixed-citation xml:lang="ru">Hafez A. M. First evaluation of field evolved resistance to commonly used insecticides in house fly populations from Saudi Arabian dairy farms. Insects. 2021; 12 (12):1120. https://doi.org/10.3390/insects12121120</mixed-citation><mixed-citation xml:lang="en">Hafez A. M. First evaluation of field evolved resistance to commonly used insecticides in house fly populations from Saudi Arabian dairy farms. Insects. 2021; 12 (12):1120. https://doi.org/10.3390/insects12121120</mixed-citation></citation-alternatives></ref><ref id="cit16"><label>16</label><citation-alternatives><mixed-citation xml:lang="ru">Pavlov S. D., Pavlova R. P., Mavlyutov S. M. Orezistentnosti nasekomykh kompleksa gnus i komnatnoi mukhi k deistviyu sovremennykh insektitsidov = On resistance of gnat and housefly complex against modern insecticides. Entomologicheskie issledovaniya v Severnoi Azii: materialy VIIMezhregional’nogo soveshchaniya entomologov Sibiri iDal’nego Vostoka v ramkakh Sibirskoi zoologicheskoi konferentsii (Novosibirsk, 20–24 sentyabrya 2006 g.) = Entomological studies in Northern Asia: Proceedings of the VII Interregional Meeting of Entomologists of Siberia and the Far East within the framework of the Siberian Zoological Conference (Novosibirsk, September 20–24, 2006). Novosibirsk: Institute of Systematics and Ecology of Animals of Siberian Branch of Russian Academy of Sciences; 2006; 416–418. https://elibrary.ru/ttwhrz (in Russ.)</mixed-citation><mixed-citation xml:lang="en">Pavlov S. D., Pavlova R. P., Mavlyutov S. M. Orezistentnosti nasekomykh kompleksa gnus i komnatnoi mukhi k deistviyu sovremennykh insektitsidov = On resistance of gnat and housefly complex against modern insecticides. Entomologicheskie issledovaniya v Severnoi Azii: materialy VIIMezhregional’nogo soveshchaniya entomologov Sibiri iDal’nego Vostoka v ramkakh Sibirskoi zoologicheskoi konferentsii (Novosibirsk, 20–24 sentyabrya 2006 g.) = Entomological studies in Northern Asia: Proceedings of the VII Interregional Meeting of Entomologists of Siberia and the Far East within the framework of the Siberian Zoological Conference (Novosibirsk, September 20–24, 2006). Novosibirsk: Institute of Systematics and Ecology of Animals of Siberian Branch of Russian Academy of Sciences; 2006; 416–418. https://elibrary.ru/ttwhrz (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit17"><label>17</label><citation-alternatives><mixed-citation xml:lang="ru">Levchenko M. A., Silivanova E. A., Hlyzova T. A., Bikinjaeva R. H., Metelitsa I. A. Susceptibility of Musca domestica (Diptera: Muscidae) field population to pyrethroid insecticides. Russian Journal “Problems of Veterinary Sanitation, Hygiene and Ecology”. 2017; (4): 71–75. https://elibrary.ru/ymeyas (in Russ.)</mixed-citation><mixed-citation xml:lang="en">Levchenko M. A., Silivanova E. A., Hlyzova T. A., Bikinjaeva R. H., Metelitsa I. A. Susceptibility of Musca domestica (Diptera: Muscidae) field population to pyrethroid insecticides. Russian Journal “Problems of Veterinary Sanitation, Hygiene and Ecology”. 2017; (4): 71–75. https://elibrary.ru/ymeyas (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit18"><label>18</label><citation-alternatives><mixed-citation xml:lang="ru">Ahmadi E., Khajehali J. Dichlorvos resistance in the house fly populations, Musca domestica, of Iranian cattle farms. Journal of Arthropod-Borne Diseases. 2020; 14 (4): 344–352. https://doi.org/10.18502/jad.v14i4.5271</mixed-citation><mixed-citation xml:lang="en">Ahmadi E., Khajehali J. Dichlorvos resistance in the house fly populations, Musca domestica, of Iranian cattle farms. Journal of Arthropod-Borne Diseases. 2020; 14 (4): 344–352. https://doi.org/10.18502/jad.v14i4.5271</mixed-citation></citation-alternatives></ref><ref id="cit19"><label>19</label><citation-alternatives><mixed-citation xml:lang="ru">Abobakr Y., Al-Hussein F. I., Bayoumi A. E., Alzabib A. A., Al-Sarar A. S. Organophosphate insecticidesresistance in field populations of house flies, Musca domestica L.: Levels of resistance and acetylcholinesterase activity. Insects. 2022; 13 (2):192. https://doi.org/10.3390/insects13020192</mixed-citation><mixed-citation xml:lang="en">Abobakr Y., Al-Hussein F. I., Bayoumi A. E., Alzabib A. A., Al-Sarar A. S. Organophosphate insecticidesresistance in field populations of house flies, Musca domestica L.: Levels of resistance and acetylcholinesterase activity. Insects. 2022; 13 (2):192. https://doi.org/10.3390/insects13020192</mixed-citation></citation-alternatives></ref><ref id="cit20"><label>20</label><citation-alternatives><mixed-citation xml:lang="ru">Eremina O. Yu., Lopatina Yu. V. Molecular genetic mechanisms of insecticide resistance in insects. Medical Parasitology and ParasiticDiseases. 2017; (4): 44–53. https://elibrary.ru/yurkfg (in Russ.)</mixed-citation><mixed-citation xml:lang="en">Eremina O. Yu., Lopatina Yu. V. Molecular genetic mechanisms of insecticide resistance in insects. Medical Parasitology and ParasiticDiseases. 2017; (4): 44–53. https://elibrary.ru/yurkfg (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit21"><label>21</label><citation-alternatives><mixed-citation xml:lang="ru">Pan J., Yang C., Liu Y., Gao Q., Li M., Qiu X. Novel cytochrome P450 (CYP6D1) and voltage sensitive sodium channel (Vssc) alleles of the house fly (Musca domestica) and their roles in pyrethroid resistance. Pest Management Science. 2018; 74 (4): 978–986. https://doi.org/10.1002/ps.4798</mixed-citation><mixed-citation xml:lang="en">Pan J., Yang C., Liu Y., Gao Q., Li M., Qiu X. Novel cytochrome P450 (CYP6D1) and voltage sensitive sodium channel (Vssc) alleles of the house fly (Musca domestica) and their roles in pyrethroid resistance. Pest Management Science. 2018; 74 (4): 978–986. https://doi.org/10.1002/ps.4798</mixed-citation></citation-alternatives></ref><ref id="cit22"><label>22</label><citation-alternatives><mixed-citation xml:lang="ru">Qu R., Zhu J., Li M., Jashenko R., Qiu X. Multiple genetic mutations related to insecticide resistance are detected in field Kazakhstani house flies (Muscidae: Diptera). Journal ofMedical Entomology. 2021; 58 (6): 2338–2348. https://doi.org/10.1093/jme/tjab110</mixed-citation><mixed-citation xml:lang="en">Qu R., Zhu J., Li M., Jashenko R., Qiu X. Multiple genetic mutations related to insecticide resistance are detected in field Kazakhstani house flies (Muscidae: Diptera). Journal ofMedical Entomology. 2021; 58 (6): 2338–2348. https://doi.org/10.1093/jme/tjab110</mixed-citation></citation-alternatives></ref><ref id="cit23"><label>23</label><citation-alternatives><mixed-citation xml:lang="ru">Li Y., Farnsworth C. A., Coppin C. W., Teese M. G., Liu J.-W., Scott C., et al. Organophosphate and pyrethroid hydrolase activities of mutant Esterases from the cotton bollworm Helicoverpa armigera. PLoS ONE. 2013; 8 (10):e77685. https://doi.org/10.1371/journal.pone.0077685</mixed-citation><mixed-citation xml:lang="en">Li Y., Farnsworth C.  A., Coppin C.  W., Teese M.  G., Liu J.-W., Scott C., et al. Organophosphate and pyrethroid hydrolase activities of mutant Esterases from the cotton bollworm Helicoverpa armigera. PLoS ONE. 2013; 8 (10):e77685. https://doi.org/10.1371/journal.pone.0077685</mixed-citation></citation-alternatives></ref><ref id="cit24"><label>24</label><citation-alternatives><mixed-citation xml:lang="ru">KimY. H., Lee S. H. Which acetylcholinesterase functions asthe main catalytic enzyme in the ClassInsecta? Insect Biochemistry andMolecular Biology. 2013; 43 (1): 47–53. https://doi.org/10.1016/j.ibmb.2012.11.004</mixed-citation><mixed-citation xml:lang="en">KimY. H., Lee S. H. Which acetylcholinesterase functions asthe main catalytic enzyme in the ClassInsecta? Insect Biochemistry andMolecular Biology. 2013; 43 (1): 47–53. https://doi.org/10.1016/j.ibmb.2012.11.004</mixed-citation></citation-alternatives></ref><ref id="cit25"><label>25</label><citation-alternatives><mixed-citation xml:lang="ru">Walsh S. B., Dolden T. A., Moores G. D., Kristensen M., Lewis T., Devonshire A. L., Williamson M. S. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. BiochemicalJournal. 2001; 359 (1): 175–181. https://doi.org/10.1042/0264-6021:3590175</mixed-citation><mixed-citation xml:lang="en">Walsh S. B., Dolden T. A., Moores G. D., Kristensen M., Lewis T., Devonshire A. L., Williamson M. S. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. BiochemicalJournal. 2001; 359 (1): 175–181. https:// doi.org/10.1042/0264-6021:3590175</mixed-citation></citation-alternatives></ref><ref id="cit26"><label>26</label><citation-alternatives><mixed-citation xml:lang="ru">Adib D., Jafari A., Silivanova E., Basseri H., Gholizadeh S. Molecular analysis of acetylcholinesterase gene in field-collected populations of Musca domestica (Diptera: Muscidae) in Northwestern Iran. Journal of Insect Science. 2023; 23 (4):9. https://doi.org/10.1093/jisesa/iead054</mixed-citation><mixed-citation xml:lang="en">Adib D., Jafari A., Silivanova E., Basseri H., Gholizadeh S. Molecular analysis of acetylcholinesterase gene in field-collected populations of Musca domestica (Diptera: Muscidae) in Northwestern Iran. Journal of Insect Science. 2023; 23 (4):9. https://doi.org/10.1093/jisesa/iead054</mixed-citation></citation-alternatives></ref><ref id="cit27"><label>27</label><citation-alternatives><mixed-citation xml:lang="ru">Alzabib A. A., Al-Sarar A. S., Abobakr Y., Saleh A. A. Single and combined mutations of acetylcholinesterase gene giving resistance to pirimiphos-methyl inMusca domestica slaughterhouse populations. Insects. 2023; 14 (3):218. https://doi.org/10.3390/insects14030218</mixed-citation><mixed-citation xml:lang="en">Alzabib A. A., Al-Sarar A. S., Abobakr Y., Saleh A. A. Single and combined mutations of acetylcholinesterase gene giving resistance to pirimiphos-methyl inMusca domestica slaughterhouse populations. Insects. 2023; 14 (3):218. https://doi.org/10.3390/insects14030218</mixed-citation></citation-alternatives></ref><ref id="cit28"><label>28</label><citation-alternatives><mixed-citation xml:lang="ru">Levchenko M. A., Silivanova E. A., Shumilova P. A., Sennikova N. A. Insecticidal susceptibility and detoxification enzyme activities in Musca domestica L. (Diptera: Muscidae) of field populations. Russian Journal “Problems of Veterinary Sanitation, Hygiene and Ecology”. 2021; (4): 428–435. https://doi.org/10.36871/vet.san.hyg.ecol.202104008 (in Russ.)</mixed-citation><mixed-citation xml:lang="en">Levchenko M. A., Silivanova E. A., Shumilova P. A., Sennikova N. A. Insecticidal susceptibility and detoxification enzyme activities in Musca domestica L. (Diptera: Muscidae) of field populations. Russian Journal “Problems of Veterinary Sanitation, Hygiene and Ecology”. 2021; (4): 428–435. https://doi.org/10.36871/vet.san.hyg.ecol.202104008 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit29"><label>29</label><citation-alternatives><mixed-citation xml:lang="ru">R 4.2.3676-20 Laboratory methods of disinfectant tests and trialsto assesstheir effectiveness and safety: a study guide. Moscow: Federal Service for the Oversight of Consumer Protection and Welfare; 2020. https://docs.cntd.ru/document/573820733 (in Russ.)</mixed-citation><mixed-citation xml:lang="en">R 4.2.3676-20 Laboratory methods of disinfectant tests and trialsto assesstheir effectiveness and safety: a study guide. Moscow: Federal Service for the Oversight of Consumer Protection and Welfare; 2020. https://docs.cntd.ru/document/573820733 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit30"><label>30</label><citation-alternatives><mixed-citation xml:lang="ru">World HealthOrganization. Manual for monitoring insecticide resistance in mosquito vectors and selecting appropriate interventions. Geneva: WorldHealthOrganization; 2022. 65 p. https://www.who.int/publications/i/item/9789240051089</mixed-citation><mixed-citation xml:lang="en">World HealthOrganization. Manual for monitoring insecticide resistance in mosquito vectors and selecting appropriate interventions. Geneva: WorldHealthOrganization; 2022. 65 p. https://www.who.int/publications/i/item/9789240051089</mixed-citation></citation-alternatives></ref><ref id="cit31"><label>31</label><citation-alternatives><mixed-citation xml:lang="ru">Udalov M. B., Benkovskaya G. V. Population genetics of the Colorado potato beetle: from genotype to phenotype. Vavilov Journal ofGenetics and Breeding. 2011; 15 (1): 156–172. https://elibrary.ru/nypugv (in Russ.)</mixed-citation><mixed-citation xml:lang="en">Udalov M. B., Benkovskaya G. V. Population genetics of the Colorado potato beetle: from genotype to phenotype. Vavilov Journal ofGenetics and Breeding. 2011; 15 (1): 156–172. https://elibrary.ru/nypugv (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit32"><label>32</label><citation-alternatives><mixed-citation xml:lang="ru">Qiu X., Pan J., Li M., Li Y. PCR-RFLP methods for detection of insecticide resistance-associated mutations in the house fly (Musca domestica). Pesticide Biochemistry and Physiology. 2012; 104 (3): 201–205. https://doi.org/10.1016/j.pestbp.2012.08.002</mixed-citation><mixed-citation xml:lang="en">Qiu X., Pan J., Li M., Li Y. PCR-RFLP methods for detection of insecticide resistance-associated mutations in the house fly (Musca domestica). Pesticide Biochemistry and Physiology. 2012; 104 (3): 201–205. https://doi.org/10.1016/j.pestbp.2012.08.002</mixed-citation></citation-alternatives></ref><ref id="cit33"><label>33</label><citation-alternatives><mixed-citation xml:lang="ru">Bender W., Spierer P., Hogness D. S., Chambon P. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster. Journal of Molecular Biology. 1983; 168 (1): 17–33. https://doi.org/10.1016/s0022-2836(83)80320-9</mixed-citation><mixed-citation xml:lang="en">Bender W., Spierer P., Hogness D. S., Chambon P. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster. Journal of Molecular Biology. 1983; 168 (1): 17–33. https://doi.org/10.1016/s0022-2836(83)80320-9</mixed-citation></citation-alternatives></ref><ref id="cit34"><label>34</label><citation-alternatives><mixed-citation xml:lang="ru">Rinkevich F. D., Zhang L., Hamm R. L., Brady S. G., Lazzaro B. P., Scott J. G. Frequencies of the pyrethroid resistance alleles of Vssc1 and CYP6D1 in house flies from the eastern United States. Insect Molecular Biology. 2006; 15 (2): 157–167. https://doi.org/10.1111/j.1365-2583.2006.00620.x</mixed-citation><mixed-citation xml:lang="en">Rinkevich F. D., Zhang L., Hamm R. L., Brady S. G., Lazzaro B. P., Scott J. G. Frequencies of the pyrethroid resistance alleles of Vssc1 and CYP6D1 in house flies from the eastern United States. Insect Molecular Biology. 2006; 15  (2): 157–167. https://doi.org/10.1111/j.1365-2583.2006.00620.x</mixed-citation></citation-alternatives></ref><ref id="cit35"><label>35</label><citation-alternatives><mixed-citation xml:lang="ru">Huang J., Kristensen M., Qiao C. L., Jespersen J. B. Frequency of kdr gene in house fly field populations: correlation of pyrethroid resistance and kdr frequency. Journal of Economic Entomology. 2004; 97 (3): 1036–1041. https://doi.org/10.1093/jee/97.3.1036</mixed-citation><mixed-citation xml:lang="en">Huang J., Kristensen M., Qiao C. L., Jespersen J. B. Frequency of kdr gene in house fly field populations: correlation of pyrethroid resistance and kdr frequency. Journal of Economic Entomology. 2004; 97 (3): 1036–1041. https://doi.org/10.1093/jee/97.3.1036</mixed-citation></citation-alternatives></ref><ref id="cit36"><label>36</label><citation-alternatives><mixed-citation xml:lang="ru">TaşkınV., Başkurt S., Doğaç E., Taşkın B. G. Frequencies of pyrethroid resistance-associated mutations of Vssc1 and CYP6D1 in field populations of Musca domestica L. inTurkey. Journal ofVector Ecology. 2011; 36 (2): 239–247. https://doi.org/10.1111/j.1948-7134.2011.00164.x</mixed-citation><mixed-citation xml:lang="en">TaşkınV., Başkurt S., Doğaç E., Taşkın B. G. Frequencies of pyrethroid resistance-associated mutations of Vssc1 and CYP6D1 in field populations of Musca domestica L. inTurkey. Journal ofVector Ecology. 2011; 36 (2): 239–247. https://doi.org/10.1111/j.1948-7134.2011.00164.x</mixed-citation></citation-alternatives></ref><ref id="cit37"><label>37</label><citation-alternatives><mixed-citation xml:lang="ru">Kamdar S., Farmani M., Akbarzadeh K., Jafari A., Gholizadeh S. Low frequency of knockdown resistance mutations in Musca domestica (Muscidae: Diptera) collected from Northwestern Iran. Journal of Medical Entomology. 2019; 56 (2): 501–505. https://doi.org/10.1093/jme/tjy177</mixed-citation><mixed-citation xml:lang="en">Kamdar S., Farmani M., Akbarzadeh K., Jafari A., Gholizadeh S. Low frequency of knockdown resistance mutations in Musca domestica (Muscidae: Diptera) collected from Northwestern Iran. Journal of Medical Entomology. 2019; 56 (2): 501–505. https://doi.org/10.1093/jme/tjy177</mixed-citation></citation-alternatives></ref><ref id="cit38"><label>38</label><citation-alternatives><mixed-citation xml:lang="ru">Hamdan M., Kamalanathan T., Iqbal A., Gnanaprakasam A. R., Shajahan S., Alsadeq M. H., et al. kdr mutations and deltamethrin resistance in house flies in Abu Dhabi, UAE. Parasites &amp; Vectors. 2024; 17 (1):47. https://doi.org/10.1186/s13071-024-06128-5</mixed-citation><mixed-citation xml:lang="en">Hamdan M., Kamalanathan T., Iqbal A., Gnanaprakasam A. R., Shajahan S., Alsadeq M. H., et al. kdr mutations and deltamethrin resistance in house flies in Abu Dhabi, UAE. Parasites &amp; Vectors. 2024; 17 (1):47. https://doi.org/10.1186/s13071-024-06128-5</mixed-citation></citation-alternatives></ref><ref id="cit39"><label>39</label><citation-alternatives><mixed-citation xml:lang="ru">Rinkevich F. D., Du Y., Dong K. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pesticide Biochemistry and Physiology. 2013; 106 (3): 93–100. https://doi.org/10.1016/j.pestbp.2013.02.007</mixed-citation><mixed-citation xml:lang="en">Rinkevich F. D., Du Y., Dong K. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pesticide Biochemistry and Physiology. 2013; 106 (3): 93–100. https://doi.org/10.1016/j.pestbp.2013.02.007</mixed-citation></citation-alternatives></ref><ref id="cit40"><label>40</label><citation-alternatives><mixed-citation xml:lang="ru">Hutton S. M., Miarinjara A., Stone N. E., Raharimalala F. N., Raveloson A. O., Rakotobe Harimanana R., et al. Knockdown resistance mutations are common and widely distributed in Xenopsylla cheopis fleas that transmit plague in Madagascar. PLoS Neglected Tropical Diseases. 2023; 17 (8):e0011401. https://doi.org/10.1371/journal.pntd.0011401</mixed-citation><mixed-citation xml:lang="en">Hutton S. M., Miarinjara A., Stone N. E., Raharimalala F. N., Raveloson A. O., Rakotobe Harimanana R., et al. Knockdown resistance mutations are common and widely distributed in Xenopsylla cheopis fleas that transmit plague in Madagascar. PLoS Neglected Tropical Diseases. 2023; 17 (8):e0011401. https://doi.org/10.1371/journal.pntd.0011401</mixed-citation></citation-alternatives></ref><ref id="cit41"><label>41</label><citation-alternatives><mixed-citation xml:lang="ru">Liu N., Li M., Gong Y., Liu F., Li T. Cytochrome P450s – Their expression, regulation, and role in insecticide resistance. Pesticide Biochemistry and Physiology. 2015; 120: 77–81. https://doi.org/10.1016/j.pestbp.2015.01.006</mixed-citation><mixed-citation xml:lang="en">Liu N., Li M., Gong Y., Liu F., Li T. Cytochrome P450s – Their expression, regulation, and role in insecticide resistance. Pesticide Biochemistry and Physiology. 2015; 120: 77–81. https://doi.org/10.1016/j. pestbp.2015.01.006</mixed-citation></citation-alternatives></ref><ref id="cit42"><label>42</label><citation-alternatives><mixed-citation xml:lang="ru">Krestonoshina K., Melnichuk A., Kinareikina A., Maslakova K., Yangirova L., Silivanova E. The P450-monooxygenase activity and CYP6D1 expression in the chlorfenapyr-resistant strain of Musca domestica L. Insects. 2024; 15 (6):461. https://doi.org/10.3390/insects15060461</mixed-citation><mixed-citation xml:lang="en">Krestonoshina K., Melnichuk A., Kinareikina A., Maslakova K., Yangirova L., Silivanova E. The P450-monooxygenase activity and CYP6D1 expression in the chlorfenapyr-resistant strain of Musca domestica L. Insects. 2024; 15 (6):461. https://doi.org/10.3390/insects15060461</mixed-citation></citation-alternatives></ref><ref id="cit43"><label>43</label><citation-alternatives><mixed-citation xml:lang="ru">Chen Z., Newcomb R., Forbes E., McKenzie J., Batterham P. The acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, Lucilia cuprina. Insect Biochemistry and Molecular Biology. 2001; 31 (8): 805–816. https://doi.org/10.1016/s0965-1748(00)00186-7</mixed-citation><mixed-citation xml:lang="en">Chen Z., Newcomb R., Forbes E., McKenzie J., Batterham P. The acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, Lucilia cuprina. Insect Biochemistry and Molecular Biology. 2001; 31 (8): 805–816. https://doi.org/10.1016/s0965-1748(00)00186-7</mixed-citation></citation-alternatives></ref><ref id="cit44"><label>44</label><citation-alternatives><mixed-citation xml:lang="ru">Mutero A., Pralavorio M., Bride J. M., Fournier D. Resistance-associated point mutationsin insecticide-insensitive acetylcholinesterase. Proceedings of the National Academy of Sciences. 1994; 91 (13): 5922–5926. https://doi.org/10.1073/pnas.91.13.5922</mixed-citation><mixed-citation xml:lang="en">Mutero A., Pralavorio M., Bride J. M., Fournier D. Resistance-associated point mutationsin insecticide-insensitive acetylcholinesterase. Proceedings of the National Academy of Sciences. 1994; 91 (13): 5922–5926. https://doi.org/10.1073/pnas.91.13.5922</mixed-citation></citation-alternatives></ref><ref id="cit45"><label>45</label><citation-alternatives><mixed-citation xml:lang="ru">Menozzi P., Shi M. A., Lougarre A., Tang Z. H., Fournier D. Mutations of acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster populations. BMC Evolutionary Biology. 2004; 4:4. https://doi.org/10.1186/1471-2148-4-4</mixed-citation><mixed-citation xml:lang="en">Menozzi P., Shi M. A., Lougarre A., Tang Z. H., Fournier D. Mutations of acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster populations. BMC Evolutionary Biology. 2004; 4:4. https://doi.org/10.1186/1471-2148-4-4</mixed-citation></citation-alternatives></ref><ref id="cit46"><label>46</label><citation-alternatives><mixed-citation xml:lang="ru">Pereira-Castro I., van Asch B., Trindade Rei F., Teixeira Da Costa L. Bactrocera oleae (Diptera: Tephritidae) organophosphate resistance alleles in Iberia: Recent expansion and variable frequencies. European Journal of Entomology. 2015; 112 (1): 20–26. https://doi.org/10.14411/eje.2015.019</mixed-citation><mixed-citation xml:lang="en">Pereira-Castro I., van Asch B., Trindade Rei F., Teixeira Da Costa L. Bactrocera oleae (Diptera: Tephritidae) organophosphate resistance alleles in Iberia: Recent expansion and variable frequencies. European Journal of Entomology. 2015; 112 (1): 20–26. https://doi.org/10.14411/eje.2015.019</mixed-citation></citation-alternatives></ref><ref id="cit47"><label>47</label><citation-alternatives><mixed-citation xml:lang="ru">Hsu J.-C., Haymer D. S., Wu W.-J., Feng H.-T. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides. Insect Biochemistry and Molecular Biology. 2006; 36 (5): 396–402. https://doi.org/10.1016/j.ibmb.2006.02.002</mixed-citation><mixed-citation xml:lang="en">Hsu J.-C., Haymer D. S., Wu W.-J., Feng H.-T. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides. Insect Biochemistry and Molecular Biology. 2006; 36 (5): 396–402. https://doi.org/10.1016/j.ibmb.2006.02.002</mixed-citation></citation-alternatives></ref><ref id="cit48"><label>48</label><citation-alternatives><mixed-citation xml:lang="ru">Başkurt S., Taşkın B. G., Doğaç E., Taşkın V. Polymorphism in the acetylcholinesterase gene of Musca domestica L. field populations in Turkey. Journal of Vector Ecology. 2011; 36 (2): 248–257. https://doi.org/10.1111/j.1948-7134.2011.00165.x</mixed-citation><mixed-citation xml:lang="en">Başkurt S., Taşkın B. G., Doğaç E., Taşkın V. Polymorphism in the acetylcholinesterase gene of Musca domestica L. field populations in Turkey. Journal of Vector Ecology. 2011; 36 (2): 248–257. https://doi.org/10.1111/j.1948-7134.2011.00165.x</mixed-citation></citation-alternatives></ref><ref id="cit49"><label>49</label><citation-alternatives><mixed-citation xml:lang="ru">Yang X., Mou R., Liang Q., Cheng J., Wu Y., Tan W., Wu J. Frequency and polymorphism of acetylcholinesterase gene involved in the organophosphate resistance of Musca domestica in Guizhou Province, China. Archives of Insect Biochemistry and Physiology. 2023; 114 (3):e22045. https://doi.org/10.1002/arch.22045</mixed-citation><mixed-citation xml:lang="en">Yang X., Mou R., Liang Q., Cheng J., Wu Y., Tan W., Wu J. Frequency and polymorphism of acetylcholinesterase gene involved in the organophosphate resistance of Musca domestica in Guizhou Province, China. Archives of Insect Biochemistry and Physiology. 2023; 114 (3):e22045. https://doi.org/10.1002/arch.22045</mixed-citation></citation-alternatives></ref></ref-list><fn-group><fn fn-type="conflict"><p>The authors declare that there are no conflicts of interest present.</p></fn></fn-group></back></article>
