<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3.dtd">
<article article-type="research-article" dtd-version="1.3" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xml:lang="en"><front><journal-meta><journal-id journal-id-type="publisher-id">veterinary</journal-id><journal-title-group><journal-title xml:lang="en">Veterinary Science Today</journal-title><trans-title-group xml:lang="ru"><trans-title>Ветеринария сегодня</trans-title></trans-title-group></journal-title-group><issn pub-type="ppub">2304-196X</issn><issn pub-type="epub">2658-6959</issn><publisher><publisher-name>"Veinard"</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.29326/2304-196X-2025-14-1-76-81</article-id><article-id custom-type="elpub" pub-id-type="custom">veterinary-896</article-id><article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject></subj-group><subj-group subj-group-type="section-heading" xml:lang="en"><subject>ORIGINAL ARTICLES | VETERINARY MICROBIOLOGY</subject></subj-group><subj-group subj-group-type="section-heading" xml:lang="ru"><subject>ОРИГИНАЛЬНЫЕ СТАТЬИ | ВЕТЕРИНАРНАЯ МИКРОБИОЛОГИЯ</subject></subj-group></article-categories><title-group><article-title>Polymorphisms in TLR4 gene associated with risks of bovine mastitis development</article-title><trans-title-group xml:lang="ru"><trans-title>Ассоциации полиморфизмов гена TLR4 с риском развития мастита крупного рогатого скота</trans-title></trans-title-group></title-group><contrib-group><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-3622-3770</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Бытов</surname><given-names>М. В.</given-names></name><name name-style="western" xml:lang="en"><surname>Bytov</surname><given-names>M. V.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Бытов Максим Владимирович, аспирант, младший научный сотрудник отдела геномных исследований и селекции животных</p><p>ул. Белинского, 112а, г. Екатеринбург, 620142</p></bio><bio xml:lang="en"><p>Maksim V. Bytov, Postgraduate Student, Junior Researcher, Department of  Animal Genomics and Selection</p><p>112а Belinsky str., Ekaterinburg 620142</p></bio><email xlink:type="simple">bytovmaks@mail.ru</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0009-0009-8373-6921</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Осипова</surname><given-names>Ю. А.</given-names></name><name name-style="western" xml:lang="en"><surname>Osipova</surname><given-names>Yu. A.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Осипова Юлия Алексеевна, студент, лаборант отдела геномных исследований и селекции животных</p><p>ул. Белинского, 112а, г. Екатеринбург, 620142</p></bio><bio xml:lang="en"><p>Yulia A. Osipova, Student, Laboratory Assistant, Department of Animal Genomics and Selection</p><p>112а Belinsky str., Ekaterinburg 620142</p></bio><email xlink:type="simple">osipova.j2003@gmail.com</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-2970-6528</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Юсупова</surname><given-names>Ч. Р.</given-names></name><name name-style="western" xml:lang="en"><surname>Yusupova</surname><given-names>Ch. R.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Юсупова Чулпан Рифовна, д-р биол. наук, старший научный сотрудник отдела геномных исследований и селекции животных</p><p>ул. Белинского, 112а, г. Екатеринбург, 620142</p></bio><bio xml:lang="en"><p>Chulpan R. Yusupova, Dr. Sci. (Biology), Senior Researcher, Department of  Animal Genomics and Selection</p><p>112а Belinsky str., Ekaterinburg 620142</p></bio><email xlink:type="simple">chulpan-galina@mail.ru</email><xref ref-type="aff" rid="aff-1"/></contrib><contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-0284-0276</contrib-id><name-alternatives><name name-style="eastern" xml:lang="ru"><surname>Зубарева</surname><given-names>В. Д.</given-names></name><name name-style="western" xml:lang="en"><surname>Zubareva</surname><given-names>V. D.</given-names></name></name-alternatives><bio xml:lang="ru"><p>Зубарева Владлена Дмитриевна, младший научный сотрудник отдела геномных исследований и селекции животных</p><p>ул. Белинского, 112а, г. Екатеринбург, 620142</p></bio><bio xml:lang="en"><p>Vladlena D. Zubareva, Junior Researcher, Department of Animal Genomics and Selection</p><p>112а Belinsky str., Ekaterinburg 620142</p></bio><email xlink:type="simple">zzub97@mail.ru</email><xref ref-type="aff" rid="aff-1"/></contrib></contrib-group><aff-alternatives id="aff-1"><aff xml:lang="ru"><institution>ФГБНУ «Уральский федеральный аграрный научно-исследовательский центр Уральского отделения Российской академии наук» (ФГБНУ УрФАНИЦ УрО РАН)</institution><country>Россия</country></aff><aff xml:lang="en"><institution>Ural Federal Agrarian Scientific Research Center, Ural Branch of the Russian Academy of Sciences</institution><country>Russian Federation</country></aff></aff-alternatives><pub-date pub-type="collection"><year>2025</year></pub-date><pub-date pub-type="epub"><day>22</day><month>03</month><year>2025</year></pub-date><volume>14</volume><issue>1</issue><fpage>76</fpage><lpage>81</lpage><permissions><copyright-statement>Copyright &amp;#x00A9; Bytov M.V., Osipova Y.A., Yusupova C.R., Zubareva V.D., 2025</copyright-statement><copyright-year>2025</copyright-year><copyright-holder xml:lang="ru">Бытов М.В., Осипова Ю.А., Юсупова Ч.Р., Зубарева В.Д.</copyright-holder><copyright-holder xml:lang="en">Bytov M.V., Osipova Y.A., Yusupova C.R., Zubareva V.D.</copyright-holder><license license-type="creative-commons-attribution" xlink:href="https://creativecommons.org/licenses/by/4.0/" xlink:type="simple"><license-p>This work is licensed under a Creative Commons Attribution 4.0 License.</license-p></license></permissions><self-uri xlink:href="https://veterinary.arriah.ru/jour/article/view/896">https://veterinary.arriah.ru/jour/article/view/896</self-uri><abstract><sec><title>Introduction</title><p>Introduction. Inflammatory mammary diseases in cows remain the most common challenge in dairy industry, notwithstanding the improved preventive measures and treatment schemes. One of the methods to prevent mastitis in dairy cows is the genetic selection of the most disease-resistant individuals. Toll-like receptor 4 (TLR4) plays a central role in the innate immune response. There are publications about TLR4 significance for mastitis development, its genetic polymorphisms associated with somatic cell counts.</p></sec><sec><title>Objective</title><p>Objective. Determination of genetic diversity and association with the development of clinical mastitis for three polymorphic locuses of TLR4.</p></sec><sec><title>Materials and methods</title><p>Materials and methods. To achieve the objective cattle health history (n = 421) was used, subclinical mastitis was diagnosed using rapid test for somatic cell counting in milk, TaqMan real-time polymerase chain reaction was used for genotyping of cattle for rs8193046, rs8193060, rs29017188 polymorphisms. Results. Association studies established that rs8193046 и rs29017188 polymorphisms are the most promising candidates to be used in selection programs aimed at mastitis risk mitigation in the Ural populations. For rs8193060 no reliable results of association tests are obtained, though risk of mastitis in GCG haplotype-animals (for SNP rs8193046, rs8193060, rs29017188 alleles) is statistically lower.</p></sec><sec><title>Conclusion</title><p>Conclusion. It is noted that the abovementioned polymorphisms can be used for marker-assisted selection of cattle to prevent risks of mastitis in the populations in the Ural.</p></sec></abstract><trans-abstract xml:lang="ru"><sec><title>Введение</title><p>Введение. Воспалительные заболевания молочной железы коров остаются наиболее распространенной проблемой молочного скотоводства, несмотря на оптимизируемые профилактические меры и схемы лечения. Одним из способов предупреждения развития мастита у коров молочного направления продуктивности является генетическая селекция наиболее устойчивых к заболеванию особей. Толл-подобный рецептор 4 (TLR4) играет ключевую роль во врожденном иммунитете, в литературе имеются данные о его значимом влиянии на развитие мастита, описаны ассоциации генетических полиморфизмов гена TLR4 со значениями индекса соматических клеток.</p></sec><sec><title>Цель исследования</title><p>Цель исследования. Определение генетического разнообразия и степени ассоциации с развитием клинического мастита для 3 полиморфных локусов, расположенных в гене TLR4.</p></sec><sec><title>Материалы и методы</title><p>Материалы и методы. Для достижения поставленной цели использованы данные анамнеза крупного рогатого скота (n = 421), проведена диагностика субклинического мастита при помощи экспресс-теста для определения количества соматических клеток в молоке, при генотипировании крупного рогатого скота по полиморфизмам rs8193046, rs8193060, rs29017188 применена полимеразная цепная реакция в реальном времени по технологии TaqMan.</p></sec><sec><title>Результаты</title><p>Результаты. При проведении ассоциативных тестов установлено, что полиморфизмы rs8193046 и rs29017188 являются наиболее перспективными кандидатами для использования в селекционных программах для снижения риска заболеваемости маститом в популяциях Уральского региона. Для rs8193060 отдельно достоверных результатов ассоциативных тестов не выявлено, однако животные с гаплотипом GCG (для аллелей SNP rs8193046, rs8193060, rs29017188) имеют статистически значимый более низкий риск развития мастита.</p></sec><sec><title>Заключение</title><p>Заключение. Отмечено, что данные полиморфизмы можно использовать для маркер-ориентированной селекции крупного рогатого скота для профилактики риска развития мастита в популяциях Уральского региона.</p></sec></trans-abstract><kwd-group xml:lang="ru"><kwd>TLR4</kwd><kwd>мастит</kwd><kwd>крупный рогатый скот</kwd><kwd>риск развития заболевания</kwd><kwd>ассоциативные тесты</kwd></kwd-group><kwd-group xml:lang="en"><kwd>TLR4</kwd><kwd>mastitis</kwd><kwd>cattle</kwd><kwd>risk of disease development</kwd><kwd>association tests</kwd></kwd-group><funding-group><funding-statement xml:lang="ru">Работа выполнена в рамках государственного задания Минобрнауки России по теме № 0532-2022-0001 «Разработка технологии для маркер-ориентированной селекции крупного рогатого скота по генам, ассоциированным с устойчивостью к заболеваниям».</funding-statement><funding-statement xml:lang="en">The research was carried out within the framework of the state assignment of the Ministry of Education and Science of Russia No. 0532-2022-0001 “Development of technology for marker-assisted selection of cattle for genes associated with disease resistance”.</funding-statement></funding-group></article-meta></front><body><sec><title>INTRODUCTION</title><p>Inflammation of a mammary gland (mastitis) is one of the costliest diseases in cattle. Preventive measures and treatment regimens are being optimized, including in order to save labor and expenses. Such measures include preventive vaccination and administration of various antimicrobial drugs [<xref ref-type="bibr" rid="cit1">1</xref>][<xref ref-type="bibr" rid="cit2">2</xref>][<xref ref-type="bibr" rid="cit3">3</xref>]. An alternative to reduce mastitis incidence in farms is genetic selection. Long-term selection of dairy cattle for high milk flow, preferred due to machine milking, resulted in weakening of the mammary streak canal sphincter that represents a physical barrier for pathogen entry [<xref ref-type="bibr" rid="cit4">4</xref>]. Susceptibility to mastitis is based on a number of factors, both external (nutrition, keeping practices, stress factors, milking techniques) and internal (immune mechanisms, important to be understood in order to increase the resistance of animals) [<xref ref-type="bibr" rid="cit5">5</xref>].</p><p>The immune response plays a key role in the disease pathogenesis. Toll-like receptor 4 (TLR4), as an intrinsic immune receptor, exhibits widespread in vivo expression and its dysregulation significantly contributes to the onset of various diseases, encompassing cardiovascular disorders, neoplastic conditions, and inflammatory ailments [<xref ref-type="bibr" rid="cit6">6</xref>]. The search for associations with colibacillosis risks revealed that TLR4 (rs8193046) gene polymorphism G* allele frequency was higher in diarrheic calves than in control animals [<xref ref-type="bibr" rid="cit7">7</xref>]. In a study of the association of single nucleotide polymorphism (SNP) with the risk of paratuberculosis caused by Mycobacterium avium, it was shown that A/G heterozygotes produced a higher risk of this infectious disease [<xref ref-type="bibr" rid="cit8">8</xref>]. An experiment aimed to find polymorphism haplotypes in TLR4 gene and conducted in different cattle populations revealed that the A* allele is present in all haplotypes and might negatively effect on мilk somatic cells. The C* allele also has a negative effect on this value and the G* allele might positively effect on milk somatic cells [<xref ref-type="bibr" rid="cit9">9</xref>]. It is worth noting that in this study, no corrections for multiple comparisons were made in the search for statistically significant haplotypes. At the same time, in a study of the some SNP associations with risks of subclinical mastitis, it was shown that individuals with G/G genotype had higher average somatic cell counts [<xref ref-type="bibr" rid="cit10">10</xref>].</p><p>In the case of rs8193060, indications were obtained for the association with reproductive traits: incidence of cystic ovaries, early reproductive disorders, calving ease, and production longevity [<xref ref-type="bibr" rid="cit11">11</xref>]. There is evidence of the genetic association of polymorphisms with paratuberculosis infection, moreover it was established that the C/T genotype might be beneficial [<xref ref-type="bibr" rid="cit12">12</xref>]. The study aimed to find polymorphism haplotypes in the TLR4 gene for rs8193060 produced ambiguous results: the C* allele might confer both positive and negative effects [<xref ref-type="bibr" rid="cit9">9</xref>]. The analysis of rs8193060 associations with somatic cell counts showed that T/T genotype is not beneficial [<xref ref-type="bibr" rid="cit10">10</xref>].</p><p>The rs29017188 polymorphism has the highest pleiotropic effect based on full-genome studies. There is evidence of its effect on the calving interval [<xref ref-type="bibr" rid="cit13">13</xref>], lactation persistence [<xref ref-type="bibr" rid="cit14">14</xref>] and milk composition [<xref ref-type="bibr" rid="cit15">15</xref>].</p><p>Unfortunately, to date, no mechanisms have been identified for how exactly TLR4 gene polymorphisms affect the body’s immune functions. Bhat R. R. et al. described the supposed mechanism of SNPs falling in TLR4 promoter and 5’ untranslated region. Researchers have found absence of heterozygous condition in these loci in individuals with susceptibility to mastitis, which is most likely due to transcriptional factor binding proﬁle, which ultimately changes the expression of this gene [<xref ref-type="bibr" rid="cit16">16</xref>].</p><p>Based on the above, the aim of the study was to analyze the genetic diversity and to search for associations of TRL4 polymorphisms with the risks of mastitis in cattle.</p></sec><sec><title>MATERIALS AND METHODS</title><p>For genotyping of 421 cattle for rs8193046, rs8193060, rs29017188, the protocol previously described by A. Q. de Mesquita et al. [<xref ref-type="bibr" rid="cit10">10</xref>] with a change in oligonucleotides for rs8193046 was used (Table 1). Herewith all animals were genotyped for rs8193060 and rs29017188, and 387 out of them for rs8193046. Animals from five farms of the Ural region were used.</p><table-wrap id="table-1"><caption><p>Table 1</p><p>Oligonucleotide sequences</p></caption><table><tbody><tr><td>SNP</td><td>Oligonucleotide sequence</td><td>Amplicon length, bp</td></tr><tr><td>rs8193046</td><td>F, GAGAGGAGAGTTGCTTGGAAGTCT</td><td>107</td></tr><tr><td>R,GCTCCATGCACTGGTAACTAATGT</td></tr><tr><td>P1, [HEX]CAGGAAGACACCGCA[ BHQ1]</td></tr><tr><td>P2, [ROX]CAGGAAGACACCACA[ BHQ2]</td></tr><tr><td>rs8193060</td><td>F, CCACTCGCTCCGGATCCT</td><td>79</td></tr><tr><td>R,CCTTGGCAAATTCTGTAGTTCTTG</td></tr><tr><td>P1, [HEX]ACTGCAGTTTCAACCGTATC[ BHQ1]</td></tr><tr><td>P2, [ROX]ACTGCAGCTTCAACCGTA[ BHQ2]</td></tr><tr><td>rs29017188</td><td>F, CCAGCTTCCTCTTGTTGTTACTTCA</td><td>150</td></tr><tr><td>R,CGGGAGGAGAGGAAGTGAGA</td></tr><tr><td>P1, [HEX]TATTTATCTCCTCTGCCACCGGA[ BHQ1]</td></tr><tr><td>P2, [ROX]TTATCTCCTCTGCCACCCGAG[ BHQ2]</td></tr></tbody></table></table-wrap><p>The criterion for inclusion an animal into a risk group was clinical and subclinical mastitis in the disease history. Rapid tests measuring somatic cell counts were used to diagnose subclinical mastitis. If no mastitis had been recorded in the animal during three lactation periods, and the rapid test showed a negative result, the animal was considered resistant to mastitis. Blood was collected from the tail vein of all animals into vacutainer tubes containing EDTA (ethylenediaminetetraacetic acid) as an anticoagulant.</p><p>The genotype distribution was analyzed for compliance with Hardy – Weinberg principle; linkage disequilibrium and the Shannon diversity index were calculated using GenAlEx package (version 6.5) for Microsoft Excel [<xref ref-type="bibr" rid="cit17">17</xref>]. Linkage disequilibrium graphs were constructed using SRplot web tool [<xref ref-type="bibr" rid="cit18">18</xref>].</p><p>Association tests for each SNP individually, the search for the most common haplotypes and their associations with mastitis risks were performed by SNPassoc R package (version 2.1.0) [<xref ref-type="bibr" rid="cit19">19</xref>].</p></sec><sec><title>RESULTS AND DISCUSSION</title><p>The allelic diversity and genotype distribution are shown in Table 2. When calculating the Hardy – Weinberg proportion, 1 degree of freedom was used. Based on the analysis results, a statistically significant deviation from equilibrium allele distribution was revealed for rs8193046 polymorphism. Such deviations can occur for a number of reasons: selective pressure, genotyping errors, inbreeding. The most likely explanation is the pressure of artificial selection.</p><table-wrap id="table-2"><caption><p>Table 2</p><p>Genotype distribution, allele frequency, and p-value of Hardy – Weinberg equilibrium</p></caption><table><tbody><tr><td>Locus</td><td>Genotype</td><td>Number of animals</td><td>Genotypic frequency, %</td><td>Alleles</td><td>Allelic frequency</td><td>X² (p-value)</td></tr><tr><td>rs8193046
G &gt; A</td><td>A/A
A/G
G/G</td><td>89
145
153</td><td>23.0
37.5
39.5</td><td>A*
G*</td><td>323
451</td><td>20.397 (&lt; 0.0001)</td></tr><tr><td>rs8193060
T &gt; C</td><td>C/C
C/T
T/T</td><td>184
191
46</td><td>43.7
45.4
10.9</td><td>C*
T*</td><td>559
283</td><td>0.116 (0.734)</td></tr><tr><td>rs29017188
G &gt; C</td><td>C/C
C/G
G/G</td><td>75
212
134</td><td>17.8
50.4
31.8</td><td>C*
G*</td><td>362
480</td><td>0.314 (0.575)</td></tr></tbody></table></table-wrap><p>Based on the linkage disequilibrium analysis, it can be concluded that the pairs of rs8193046 and rs8193060 alleles, as well as rs29017188 and rs8193060 demonstrate linkage disequilibrium: R² = 0.2 and R² = 0.4, respectively (Fig. 1).</p><fig id="fig-1"><caption><p>Fig. 1. Linkage disequilibrium (R²) plot of the studied SNPs</p></caption><graphic xlink:href="veterinary-14-1-g001.jpeg"><uri content-type="original_file">https://cdn.elpub.ru/assets/journals/porozendo/2025/1/fut70208kNEY2UIYIT2mtS6WHPnOSrDlfDzcanfA.jpeg</uri></graphic></fig><p>The genetic diversity of the studied cattle populations was also evaluated by TLR4 gene polymorphisms. The Shannon diversity index approaching 1 reflects a high diversity level. Thanks to the analysis, it was found that the diversity between populations is low (D’ = 0.015). However, on average, a higher diversity index value (D’ = 0.403) can be observed within populations, from which it can be concluded that they are genetically stable (Fig. 2). Since there are no differences in the diversity for these polymorphisms between the studied populations, further tests were performed jointly.</p><fig id="fig-2"><caption><p>Fig. 2. Shannon diversity index for intra- and interpopulation assessment: D’ – diversity index; O’ – overlap index</p></caption><graphic xlink:href="veterinary-14-1-g002.jpeg"><uri content-type="original_file">https://cdn.elpub.ru/assets/journals/porozendo/2025/1/KLZkzpKAuBWnAuus5tAe0cMdZCqkPW8aFC7je4Kf.jpeg</uri></graphic></fig><p>Association tests were performed individually for each of the TLR4 gene polymorphisms to identify associations with mastitis risks. А summary of the results is presented in Table 3: rs29017188 SNP showed the largest number of statistically significant inheritance models, including taking into account the Bonferroni correction, while the recessive inheritance of mastitis risk was significant for rs8193046 and rs29017188. The recessive inheritance for rs8193046 also has the lowest Akaike information criterion (AIC) value, and the odds ratio (OR) suggests that animals with A/A genotype have a higher risk of mastitis. For rs29017188, the recessive inheritance model also had the lowest AIC value, OR for the C/C genotype was 2.30, this means the risk of mastitis is presumably more than 2 times higher in individuals of the studied populations.</p><table-wrap id="table-3"><caption><p>Table 3</p><p>Results of association tests for each of the SNPs for five inheritance models</p></caption><table><tbody><tr><td>SNP</td><td>Codominant</td><td>Dominant</td><td>Recessive</td><td>Overdominant</td><td>log-additive</td></tr><tr><td>rs8193046</td><td>0.04887*</td><td>0.17175</td><td>0.01478*</td><td>0.47568</td><td>0.02935*</td></tr><tr><td>rs8193060</td><td>0.51985</td><td>0.34612</td><td>0.73568</td><td>0.25287</td><td>0.58147</td></tr><tr><td>rs29017188</td><td>0.00671*</td><td>0.06545</td><td>0.00248*</td><td>0.57736</td><td>0.00368*</td></tr><tr><td>* p-value ≤ 0.05; in bold – p-value ≤ 0.016 (Bonferroni correction).</td></tr></tbody></table></table-wrap><p>The results of the haplotype search showed that ACC, GCG, and GTG (for the rs8193046, rs8193060, and rs29017188 SNP alleles, respectively) are the most common, accounting for more than 85% of the total sample (Table 4).</p><table-wrap id="table-4"><caption><p>Table 4</p><p>Haplotypes and their associations with mastitis risks</p></caption><table><tbody><tr><td>rs8193046, rs8193060, rs29017188</td><td>Frequency</td><td>OR</td><td>95% confidence interval</td><td>p-value</td></tr><tr><td>ACC</td><td>0.3491</td><td>1.00</td><td>reference haplotype</td><td>–</td></tr><tr><td>GCC</td><td>0.0643</td><td>0.86</td><td>0.45–1.64</td><td>0.6515</td></tr><tr><td>GCG</td><td>0.2145</td><td>0.53</td><td>0.36–0.80</td><td>0.0022*</td></tr><tr><td>GTG</td><td>0.3020</td><td>0.74</td><td>0.52–1.05</td><td>0.0894</td></tr><tr><td>Other rare haplotypes</td><td>0.0701</td><td>0.60</td><td>0.33–1.12</td><td>0.1083</td></tr><tr><td>* p-value ≤ 0.05; in bold – p-value ≤ 0.016 (Bonferroni correction).</td></tr></tbody></table></table-wrap><p>Animals with the GCG haplotype have a statistically significant lower risk of mastitis (for SNPs rs8193046, rs8193060, rs29017188). We assume that an increase in the proportion of individuals with this haplotype in farms where mastitis in dairy cows is challenging may have a positive effect on the disease occurrence. The results of the search for associations of haplotypes with phenotypes coincide with the results of the identification of individual polymorphism associations and are more consistent with the data obtained by P. Wang et al. [<xref ref-type="bibr" rid="cit9">9</xref>].</p></sec><sec><title>CONCLUSION</title><p>In the course of the study, the genetic diversity of the Ural dairy cattle populations was analyzed. The rs8193046 polymorphism of the TRL4 gene revealed deviation from the Hardy – Weinberg equilibrium, which is most likely due to the influence of artificial selection pressure.</p><p>Based on the results of association tests, it was assumed that SNP rs8193046 and rs29017188 are the most promising candidates for use in breeding programs to reduce the risk of mastitis in the studied populations. It is worth noting the low effectiveness of genomic estimate extrapolation even among populations of the same breed; however, the results obtained during the study coincide with the previously published data [<xref ref-type="bibr" rid="cit9">9</xref>]. The GCG haplotype for rs8193046, rs8193060, and rs29017188 was found to be statistically significant based on the association tests. This haplotype can be probably used for positive selection to reduce the risk of clinical mastitis in dairy cattle populations.</p></sec></body><back><ref-list><title>References</title><ref id="cit1"><label>1</label><citation-alternatives><mixed-citation xml:lang="ru">Исакова М. Н., Ряпосова М. В., Опарина О. Ю. Изменения показателей иммунного статуса коров на фоне применения противомаститной вакцины. Ветеринарный фармакологический вестник. 2019; (1): 91–95. https://doi.org/10.17238/issn2541-8203.2019.1.91</mixed-citation><mixed-citation xml:lang="en">Isakova M. N., Ryaposova M. V., Oparina O. Yu. Changesin the indices of general resistance of the organism of cows on the background of the use of anti-mastitis vaccines. Bulletin of Veterinary Pharmacology. 2019; (1): 91–95. https://doi.org/10.17238/issn2541-8203.2019.1.91 (in Russ.)</mixed-citation></citation-alternatives></ref><ref id="cit2"><label>2</label><citation-alternatives><mixed-citation xml:lang="ru">Исакова М. Н., Лысова Я. Ю. Влияние композиции на основе бактериоцина низина в схеме лечения коров с субклиническим маститом на микробиоту молока. Ветеринария сегодня. 2024; 13 (3): 261–268. https://doi.org/10.29326/2304-196X-2024-13-3-261-268</mixed-citation><mixed-citation xml:lang="en">Isakova M. N., LysovaYa. Yu. The effect of the nisin-based pharmaceutical formulation used in the treatment plan for cows with subclinical mastitis on the milk microbiota. Veterinary Science Today. 2024; 13 (3): 261–268. https://doi.org/10.29326/2304-196X-2024-13-3-261-268</mixed-citation></citation-alternatives></ref><ref id="cit3"><label>3</label><citation-alternatives><mixed-citation xml:lang="ru">Дроздова Л. И., Баркова А. С., Исакова М. Н., Ларионов Л. П., Пермикин В. В., Стариков Н. М., Хонина Т. Г. Оценка ранозаживляющего эффекта кремнийцинкборсодержащего глицерогидрогеля и влияние его на молочную железу высокопродуктивных коров. Ветеринария сегодня. 2023; 12 (4): 322–330. https://doi.org/10.29326/2304-196X-2023-12-4-322-330</mixed-citation><mixed-citation xml:lang="en">Drozdova L. I., Barkova A. S., Isakova M. N., Larionov L. P., Permikin V. V., Starikov N. M., Khonina T. G. Evaluating wound-healing effect of silicon-zinc-boron-containing glycerohydrogel and its effect on mammary glands of high producing dairy cows. Veterinary Science Today. 2023; 12 (4): 322–330. https://doi.org/10.29326/2304-196X-2023-12-4-322-330</mixed-citation></citation-alternatives></ref><ref id="cit4"><label>4</label><citation-alternatives><mixed-citation xml:lang="ru">Brajnik Z., Ogorevc J. Candidate genesfor mastitis resistance in dairy cattle: a data integration approach. Journal of Animal Science and Biotechnology. 2023; 14:10. https://doi.org/10.1186/s40104-022-00821-0</mixed-citation><mixed-citation xml:lang="en">Brajnik Z., Ogorevc J. Candidate genesfor mastitis resistance in dairy cattle: a data integration approach. Journal of Animal Science and Biotechnology. 2023; 14:10. https://doi.org/10.1186/s40104-022-00821-0</mixed-citation></citation-alternatives></ref><ref id="cit5"><label>5</label><citation-alternatives><mixed-citation xml:lang="ru">Zemanova M., Langova L., Novotná I., Dvorakova P., Vrtkova I., Havlicek Z. Immune mechanisms, resistance genes, and their roles in the prevention of mastitisin dairy cows. Archives Animal Breeding. 2022; 65 (4): 371–384. https://doi.org/10.5194/aab-65-371-2022</mixed-citation><mixed-citation xml:lang="en">Zemanova M., Langova L., Novotná I., Dvorakova P., Vrtkova I., Havlicek Z. Immune mechanisms, resistance genes, and their roles in the prevention of mastitisin dairy cows. Archives Animal Breeding. 2022; 65 (4): 371–384. https://doi.org/10.5194/aab-65-371-2022</mixed-citation></citation-alternatives></ref><ref id="cit6"><label>6</label><citation-alternatives><mixed-citation xml:lang="ru">Wei J., Zhang Y., Li H.,Wang F.,Yao S. Toll-like receptor 4: A potential therapeutic target for multiple human diseases. Biomedicine &amp; Pharmacotherapy. 2023; 166:115338. https://doi.org/10.1016/j.biopha.2023.115338</mixed-citation><mixed-citation xml:lang="en">Wei J., Zhang Y., Li H.,Wang F.,Yao S. Toll-like receptor 4: A potential therapeutic target for multiple human diseases. Biomedicine &amp; Pharmacotherapy. 2023; 166:115338. https://doi.org/10.1016/j.biopha.2023.115338</mixed-citation></citation-alternatives></ref><ref id="cit7"><label>7</label><citation-alternatives><mixed-citation xml:lang="ru">Judi H., Judi R., Saqban A.-K. Molecular study of colibacillosis susceptibility in calves and lambs. Nano Biomedicine and Engineering. 2020; 12 (2): 153–159. https://doi.org/10.5101/nbe.v12i2.p153-159</mixed-citation><mixed-citation xml:lang="en">Judi H., Judi R., Saqban A.-K. Molecular study of colibacillosis susceptibility in calves and lambs. Nano Biomedicine and Engineering. 2020; 12 (2): 153–159. https://doi.org/10.5101/nbe.v12i2.p153-159</mixed-citation></citation-alternatives></ref><ref id="cit8"><label>8</label><citation-alternatives><mixed-citation xml:lang="ru">Gopi B., Singh R. V., Kumar S., Kumar S., ChauhanA., KumarA., Singh S. V. Single-nucleotide polymorphisms in CLEC7A, CD209 and TLR4 gene and their association with susceptibility to paratuberculosis in Indian cattle. Journal of Genetics. 2020; 99:14. https://doi.org/10.1007/s12041-019-1172-4</mixed-citation><mixed-citation xml:lang="en">Gopi B., Singh R. V., Kumar S., Kumar S., ChauhanA., KumarA., Singh S. V. Single-nucleotide polymorphisms in CLEC7A, CD209 and TLR4 gene and their association with susceptibility to paratuberculosis in Indian cattle. Journal of Genetics. 2020; 99:14. https://doi.org/10.1007/s12041-019-1172-4</mixed-citation></citation-alternatives></ref><ref id="cit9"><label>9</label><citation-alternatives><mixed-citation xml:lang="ru">Wang X. P., Luoreng Z. M., Gao S. X., Guo D. S., LiJ. Y., Gao X., et al. Haplotype analysis of TLR4 gene and its effects on milk somatic cellscore in Chinese commercial cattle. Molecular Biology Reports. 2014; 41 (4): 2345–2351. https://doi.org/10.1007/s11033-014-3088-7</mixed-citation><mixed-citation xml:lang="en">Wang X. P., Luoreng Z. M., Gao S. X., Guo D. S., LiJ. Y., Gao X., et al. Haplotype analysis of TLR4 gene and its effects on milk somatic cellscore in Chinese commercial cattle. Molecular Biology Reports. 2014; 41 (4): 2345–2351. https://doi.org/10.1007/s11033-014-3088-7</mixed-citation></citation-alternatives></ref><ref id="cit10"><label>10</label><citation-alternatives><mixed-citation xml:lang="ru">De MesquitaA. Q., e Rezende C. S. M., de MesquitaA. J., Jardim E. A. G., Kipnis A. P. J. Association of TLR4 polymorphisms with subclinical mastitisin Brazilian holsteins. Brazilian Journal of Microbiology. 2012; 43 (2): 692–697. https://doi.org/10.1590/S1517-83822012000200034</mixed-citation><mixed-citation xml:lang="en">De MesquitaA. Q., e Rezende C. S. M., de MesquitaA. J., Jardim E. A. G., Kipnis A. P. J. Association of TLR4 polymorphisms with subclinical mastitisin Brazilian holsteins. Brazilian Journal of Microbiology. 2012; 43 (2): 692–697. https://doi.org/10.1590/S1517-83822012000200034</mixed-citation></citation-alternatives></ref><ref id="cit11"><label>11</label><citation-alternatives><mixed-citation xml:lang="ru">Novák K., Valčíková T., Samaké K., Bjelka M. Association of variants in innate immune genes TLR4 and TLR5 with reproductive and milk production traitsin Czech Simmental cattle. Genes. 2023; 15 (1):24. https://doi.org/10.3390/genes15010024</mixed-citation><mixed-citation xml:lang="en">Novák K., Valčíková T., Samaké K., Bjelka M. Association of variants in innate immune genes TLR4 and TLR5 with reproductive and milk production traitsin Czech Simmental cattle. Genes. 2024; 15 (1):24. https://doi.org/10.3390/genes15010024</mixed-citation></citation-alternatives></ref><ref id="cit12"><label>12</label><citation-alternatives><mixed-citation xml:lang="ru">Kumar S., Kumar S., Singh R. V., Chauhan A., Kumar A., Sulabh S., et al. Genetic association of polymorphismsin bovine TLR2 and TLR4 genes with Mycobacterium avium subspecies paratuberculosis infection in Indian cattle population. Veterinary Research Communications. 2019; 43 (2): 105–114. https://doi.org/10.1007/s11259-019-09750-2</mixed-citation><mixed-citation xml:lang="en">Kumar S., Kumar S., Singh R. V., Chauhan A., Kumar A., Sulabh S., et al. Genetic association of polymorphisms in bovine TLR2 and TLR4 genes with Mycobacterium avium subspecies paratuberculosis infection in Indian cattle population. Veterinary Research Communications. 2019; 43 (2): 105–114. https://doi.org/10.1007/s11259-019-09750-2</mixed-citation></citation-alternatives></ref><ref id="cit13"><label>13</label><citation-alternatives><mixed-citation xml:lang="ru">Jecminkova K., Müller U., Kyselova J., Sztankoova Z., Zavadilova L., Stipkova M., Majzlik I. Association of leptin, toll-like receptor 4, and chemokine receptor of interleukin 8 C-X-C motifsingle nucleotide polymorphisms with fertility traits in Czech Fleckvieh cattle. Asian-Australasian Journal of Animal Sciences. 2018; 31 (11): 1721–1728. https://doi.org/10.5713/ ajas.17.0900</mixed-citation><mixed-citation xml:lang="en">Jecminkova K., MüllerU., Kyselova J., Sztankoova Z., Zavadilova L., Stipkova M., Majzlik I. Association of leptin, toll-like receptor 4, and chemokine receptor of interleukin 8 C-X-C motifsingle nucleotide polymorphisms with fertility traits in Czech Fleckvieh cattle. Asian-Australasian Journal of Animal Sciences. 2018; 31 (11): 1721–1728. https://doi.org/10.5713/ajas.17.0900</mixed-citation></citation-alternatives></ref><ref id="cit14"><label>14</label><citation-alternatives><mixed-citation xml:lang="ru">Sharma B. S., Leyva I., Schenkel F., Karrow N. A. Association of tolllike receptor 4 polymorphisms with somatic cell score and lactation per sistency in Holstein bulls. Journal of Dairy Science. 2006; 89 (9): 3626–3635. https://doi.org/10.3168/jds.S0022-0302(06)72402-X</mixed-citation><mixed-citation xml:lang="en">Sharma B. S., Leyva I., Schenkel F., Karrow N. A. Association of tolllike receptor 4 polymorphisms with somatic cell score and lactation persistency in Holstein bulls. Journal of Dairy Science. 2006; 89 (9): 3626–3635. https://doi.org/10.3168/jds.S0022-0302(06)72402-X</mixed-citation></citation-alternatives></ref><ref id="cit15"><label>15</label><citation-alternatives><mixed-citation xml:lang="ru">Wang M., Song H., Zhu X., Xing S., Zhang M., Zhang H., et al. Toll-like receptor 4 gene polymorphisms influence milk production traitsin Chinese Holstein cows. Journal of Dairy Research. 2018; 85 (4): 407–411. https://doi.org/10.1017/s0022029918000535</mixed-citation><mixed-citation xml:lang="en">Wang M., Song H., Zhu X., Xing S., Zhang M., Zhang H., et al. Toll-like receptor 4 gene polymorphisms influence milk production traitsin Chinese Holstein cows. Journal of Dairy Research. 2018; 85 (4): 407–411. https://doi.org/10.1017/s0022029918000535</mixed-citation></citation-alternatives></ref><ref id="cit16"><label>16</label><citation-alternatives><mixed-citation xml:lang="ru">Bhat R. R., Bhat N. N., Shabir A., Mir M. U. R., Ahmad S. B., Hussain I., et al. SNP analysis of TLR4 promoter and its transcriptional factor binding profile in relevance to bovine subclinical mastitis. Biochemical Genetics. 2024; 62 (5): 3605–3623. https://doi.org/10.1007/s10528-023- 10578-4</mixed-citation><mixed-citation xml:lang="en">Bhat R. R., BhatN. N., ShabirA., Mir M. U. R., Ahmad S. B., Hussain I., et al. SNP analysis of TLR4 promoter and its transcriptional factor binding profile in relevance to bovine subclinical mastitis. Biochemical Genetics. 2024; 62 (5): 3605–3623. https://doi.org/10.1007/s10528-023-10578-4</mixed-citation></citation-alternatives></ref><ref id="cit17"><label>17</label><citation-alternatives><mixed-citation xml:lang="ru">Peakall R., Smouse P. E. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes. 2006; 6 (1): 288–295. https://doi.org/10.1111/j.1471-8286.2005.01155.x</mixed-citation><mixed-citation xml:lang="en">Peakall R., Smouse P. E. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes. 2006; 6 (1): 288–295. https://doi.org/10.1111/j.1471-8286.2005.01155.x</mixed-citation></citation-alternatives></ref><ref id="cit18"><label>18</label><citation-alternatives><mixed-citation xml:lang="ru">TangD., Chen M., Huang X., ZhangG., Zeng L., ZhangG., et al. SRplot: A free online platform for data visualization and graphing. PLoSONE. 2023; 18 (11):e0294236. https://doi.org/10.1371/journal.pone.0294236</mixed-citation><mixed-citation xml:lang="en">Tang D., Chen M., Huang X., Zhang G., Zeng L., Zhang G., et al. SRplot: A free online platform for data visualization and graphing. PLoS ONE. 2023; 18 (11):e0294236. https://doi.org/10.1371/journal.pone.0294236</mixed-citation></citation-alternatives></ref><ref id="cit19"><label>19</label><citation-alternatives><mixed-citation xml:lang="ru">González J. R., Armengol L., Solé X., Guinó E., MercaderJ. M., Estivill X., Moreno V. SNPassoc: an R package to perform whole genome association studies. Bioinformatics. 2007; 23 (5): 644–645. https://doi.org/10.1093/bioinformatics/btm025</mixed-citation><mixed-citation xml:lang="en">González J. R., Armengol L., Solé X., Guinó E., MercaderJ. M., Estivill X., Moreno V. SNPassoc: an R package to perform whole genome association studies. Bioinformatics. 2007; 23 (5): 644–645. https://doi.org/10.1093/bioinformatics/btm025</mixed-citation></citation-alternatives></ref></ref-list><fn-group><fn fn-type="conflict"><p>The authors declare that there are no conflicts of interest present.</p></fn></fn-group></back></article>
